Specimens found in “Japan, Minna Jima” (1)

Specimen 659

Species Rotaliida > Nummulitidae > Cycloclypeus > Cycloclypeus carpenteri
Isolate number 659
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1997
Habitat soft sediment
Location Japan, Minna Jima

Barcode sequence

SSU partial

>Cycloclypeus carpenteri | genomic DNA | 659 | taxon:196926 | 1 | Japan:Minna Jima | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggcccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcgtctttacccggcttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggccacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Cycloclypeus carpenteri | genomic DNA | 659 | taxon:196926 | 14 | Japan:Minna Jima | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagcttagcccgtcgatataatccattcttagctgtcgtacttcggtacatccgctggaaggaattgtagcatcgaaagcattcaagttgtattcatactgcaagcataataatacacacatacacaccccgctgcaagtactatcgtaatacatacagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatgaaatttgatatactctctcgtaagtacacacacgcagtcttatattatatatgctccatgcagtgatatatatacgcatcacgcgtcgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI