Specimens found in “Adriatic Sea, Lagoon of Venice, Italy” (1)

Specimen 243

Ammonia aberdoveyensis T2_243, spiral view Ammonia aberdoveyensis T2_243, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aberdoveyensis T2
Isolate number 243
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1995
Habitat salt marsh
Depth <1m
Location Adriatic Sea, Lagoon of Venice, Italy

Barcode sequences

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 7 | France:Camargue, Le Boucanet | Aug-1995 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagttcgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgagtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcatgttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatgaatctataggactgccaaagctttttggagcttagtggaaatatatatgnnnnnnnngatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 5 | France:Camargue, Le Boucanet | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagtccgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgcgtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacgggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtggcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgggttatgctatgaatctataggactgccaaagtacgcgtttcggcgccgcttagtggaaatatatatnnnnnncgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. | genomic DNA | VS13 | taxon:43993 | 6 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatgccaatatataatatgtacctcgcgtgcataaattagcccgtcgatactatcctagcgtatgtcaccggtcttcgggtcggtactcaaatacgcgggaattgtagcatcgtaataattaaaaaatatacagcacacacacacacacacacataagaacccacgccaacacagcgtacaccacttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttcaccctttagtacgcacacacatacaccaatggcgcggcgtgcgagtgcacaacgtatatatactataacctgagtcgagttattt

See sequence on NCBI