Specimens found in “Sweden, Tjärnö” (4)

Specimen 1396

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 1396
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 1396 | taxon:313611 | 1396.3 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgttgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgccacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcattttatttcagttccattcatttggttctgtttttaagtgtgtttttgcttctgcgcgcggtaaagcctactttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaaggcgtaacaaggcatcggtaggtga

See sequence on NCBI

Specimen 523

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 523
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Bulimina marginata | genomic DNA | 523 | taxon:313259 | small subunit ribosomal RNA ttaccgggtccggcacactgaggattgacaggcaatattagcacttagcttcttgcgacgggttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaccaagggcctataattttacgtgtgttgcggcactttgacccctctttttttaaagagcgcgggtcttggttngcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgggcatatgnaattttttnaaattgctttgcgcgcaaaaaggntttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggnctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcaggagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI

Specimen 559

Ammonia sp. T3_559, umbilical view Ammonia sp. T3_559, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 559
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 4 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcacgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtgtacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcaccggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcactgcactgtgcatctaacccaatgtgcgcggacgccacgatgtgtaattgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtgggggtagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcggcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 5 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcncgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagngatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccaaaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccacgatatgtatttgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgccttcgtgtgagtgcagtgcgtagcttgctgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcgcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. AS2 | genomic DNA | AS2 | taxon:155587 | 43 | true | Sweden:Tjaerno, Koesterfjorden | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctctaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcatattgcggagaccgatagcatacaagtaccgtaagggaacgatgaaaagcaccctattgagttcacggcgcagacttgcttcggttcgccgttgcttgtcccgcgcccaacaactacagtgggagtgaaagagagagtgaaatcgcctatacataaacaaatatactatatgcacacacacacacagtgtaattgcatacagcatacacacagtctgcgttagtacaatcggacagagtgtcgtataactttatatggccgcctaatatacgcacacacacaatgtattttatggtctggctcatagccggtttcgaccgctatacgcgacacaactgtacgacccgttttgaaacacggaccaaggagttcaactggattacgagtcgtagagtaacatgtatctatatacaactatatttacactcacacggcatagcgaaagcaacttaatcctttactgtgctaggtcggccctcaaaagctgaccgcagcacgcgctgagtgtgtatatacgtgagggccttagtgtcaacgcgtatacctgtcacagcttcggctgctaacaggatcactcaagcgttcaacgagtatatcttgttgagacccgaaagatggtgaactatgctcggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctgagtataggggcgaaagactcaacgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI

Specimen 560

Ammonia sp. T3_560, spiral view Ammonia sp. T3_560, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 560
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial
SSU partial

Other sequences

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 3 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 2 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatacgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI