Specimens found in “USA, Washington State, Grays Harbour” (2)

Specimen 175

Ammonia sp. T10_175, umbilical view Ammonia sp. T10_175, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 175
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 3 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggnnnnnnnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctccctcgcggaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcgcgtgacacacttcggtgtgcccgcgcattaaactatagagaccgctgtttctcctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttctggtctctgtatcagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccgaagttgcaccgtctcggcggcgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 175 | genomic DNA | 175 | marine sediment | taxon:155833 | 4 | true | USA:Grays Harbour | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggctnaannngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtactctcgggtactatggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttaccgaggcgtgtgtcgcacgtacgctatgcgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttgtgcgtactaccactgcttagcatatatcgtgcctcgtgtatgattatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaatagcaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagtgcgtatactttcgggtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaccatatgtgcgcgcgggctaaccgttctggtctctgtaccagttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcgccgctcgcggtgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 175 | genomic DNA | 175 | taxon:155833 | 41 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgcaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI

Specimen 176

Ammonia sp. T10_176, spiral view Ammonia sp. T10_176, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T10
Isolate number 176
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on September 2000
Habitat salt marsh
Location USA, Washington State, Grays Harbour

Barcode sequences

SSU partial

>Ammonia sp. 176 | genomic DNA | 176 | marine sediment | taxon:155834 | 4 | true | USA:Grays Harbour, Washington State | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatataccatatgtgctctcgggcactgtggttgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgtgtatatgctgtgcggttcgtgaccccctctttacgaggcgtgtgtcgcacgtacgctatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagcgacagtgcgtacttttttggtgcgtactaccactgcttaggcgtgacacacttcggggggcccgcgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtagacgcctcagcgcgtatgctcttcggagtatgcgtatcttgagtgcgaccacgccgaacctgcttcgaaagtaaaaatttcaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacacctttatgtgcgcgcgggctaaccgttccaacctctgtgttggttcagtgcttagcacgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgcaggactgccaaagcgccgcttgcggtgcttagtggaaatatatatgaatagtgtgatctaagggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

Other sequence

LSU partial

>Ammonia sp. 176 | genomic DNA | 176 | taxon:155834 | 44 | single cell | true | USA:Grays Harbour | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataacacatatacgcgtcgttcgcgacgtgtatctttagcccgtcgatactatcctagcgtatgactctctgtctcggcagagtgtcgcctaatacgcgggaattgtagcatcgtaataaataatatacgtatatacgcgccacacacacataccaactcagtgccggccttgcaaacacacagcgctctcgcgttggaaagcaagttatatcttcggatatgccatagagtgtgacagccacgtttggaacaccactcggcaactgatacacgcgcataatacataccgtatataacctgagtaaagttattt

See sequence on NCBI