Specimens found in “New Caledonia, Titi Beach” (1)

Specimen 729

Ammonia sp. T12_729, umbilical view Ammonia sp. T12_729, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T12
Isolate number 729
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on December 2001
Habitat Marine salinity mangroves
Location New Caledonia, Titi Beach

Barcode sequences

SSU partial

>Ammonia sp. 729 | genomic DNA | 729 | marine sediment | taxon:190122 | 4 | true | New Caledonia:Titi Beach | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcatgcggtttctgttcgcagttaacccatgcttaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcactttattgcgaggcgcgtgtcgcacattcgttatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtttgcctcggcaacgacccactgcttagtatgcgttggttgcgccttcgggcaaaaactaaacgacatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcggtatgtattatttcgcttcggcgtgtgatacatatttgtttcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgttgtagcctgcctgtttcgtacgtgcccatccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctgcattgcgttcgcgcatcgcacttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 729 | genomic DNA | 729 | marine sediment | taxon:190122 | 5 | true | New Caledonia:Titi Beach | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcatagaggtttatacccctatgcttaaagatgctagctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcactttattgtgaggcgcgtgtcgcacattcgttatacgcacaggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtttgcctcggcaacgaccccactgcttagtatgcgttaggttgagccttcgggcaaaaactaaacgacatacattaaactatagagaccgctgtttcctctttaaaccagaggaaggatacggcaataacaggtctgtgatgctctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcggtatgtactatttcgcttcggcgtgtgatacatatttgtttcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgttgtagcctgtctgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctattaccgatggattatactatgaatctataggactgccaaagctgcattgcgttcgcncatcgcacttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 729 | genomic DNA | 729 | taxon:190122 | 3 | true | New Caledonia: Tieti Beach | large subunit ribosomal RNA | contains divergent D1 domain and conserved domains C1 and C2 cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataataccaactatgcgcttcggcgcataattttagcccgtcgatactatcctagcatatcaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataagaaaaaatataacaatatataataatacgccacgcacacacacacatacacaccgcgtctctgcgtacaacttgtaacaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttgactcactcacaagtacgcattcacatatactcacggcgcaccgtgccatggctgtatcaatatttatatatatatatatttttctataacctgagtcnagttattt

See sequence on NCBI