Specimens found in “Denmark, Aarhus Bay” (9)

Specimen 12285

Leptohyalis scotti_12285
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12285
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 4 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgnncngtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaaattgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtccttttcnngattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12287

Leptohyalis scotti_12287
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12287
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 7 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatctaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcgatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatattattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtattttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacctctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 8 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12288

Leptohyalis scotti_12288
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12288
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 25 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 26 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12290

Leptohyalis scotti_12290
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12290
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 29 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggcttcttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 30 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgtcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12291

Leptohyalis scotti_12291
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12291
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequence

SSU partial

>Leptohyalis scotti | genomic DNA | 12291 | marine sediment | taxon:998810 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcctcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcgntttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12292

Leptohyalis scotti_12292
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12292
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 33 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgccttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtggggaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 34 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaancatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12301

Eggerelloides scabrum_12301
Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12301
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttatttacgcctcgcgcgtaaaaaaattttaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacacacaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcgattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 17 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttnctnnattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaacttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaaataataaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcacggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12302

Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12302
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 1 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgctcttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctatatatttatttatttacgcctcgcgcgtaaaaaaaataataaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgttaacacacaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttactcttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 2 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcccttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgcgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccacaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 3 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcccttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgcgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccacaacctcttgttgcctttatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtaaaaatttatttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12303

Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12303
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcagcgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggngngatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgtaactttgacccctaattttaattaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 6 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgnnataggtggtgcatggccgtccttagttcgtggagtgatctgtctgcttaattgcgcttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI