Specimens found in “Japan, Motobu, Okinawa” (3)

Specimen 11

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 11
Collector Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 65m
Description Schizont
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

>Nummulites venosus | genomic DNA | 11 | sediment sample | taxon:159862 | single cell, Schizont | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactatttatatgtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacgttgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccattttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 8

Species Rotaliida > Nummulitidae > Operculina > Operculina discoidalis
Isolate number 8
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Depth 19m
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatagctatatgcttatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatttttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttacttttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggcttgcacacgtgctacaatgatttattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatattttatatattgcacacctatggaaacttaaacgaacagtgtggtctagaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina discoidalis | genomic DNA | 8 | sediment sample | taxon:311571 | Single cell | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattatatacgaggttgtttacgggagtaacaatttcagcgtgaatcacatcctacagtgaatcactgaaatgtactacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattcatggtacctgtatcatgtatatatatactgtacacacatacaaatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatattcatttacatacacatacacctacacaatgtattatatgtaagacaccactactcagcactcaatggtaaactttggcttcgttcgcgccgccggtttaaaggttaactgcacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagacttgcgaagttactttgcgaagcatgcatacaagcatctacagcatcaagtcccaggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaaggagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctttttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacataatacagtgtgcagcatatatataacacaattatatttactctgtcacccgacagtgtattcatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctattcattctgcgtttgatagtttttatacgcgctacctttatacggttcgcgtatcgacgctacctacaatgaaattattacctacgtatacggtttaccgtgctacagtaatatttcttataacacgcacactcgctcgctgtatcacacatatacatgacccactgcagcaactgagtgatcaatctacgatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcatagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcacgggatgttgcactttcagcctgttaagaattattacgtgcatcacacacatacacaccttgtgcacacagcgctaagtaagcttatattacgctatggatataattcataaacggttataaatgttgatggggatagtggagtcacacagtactgctggcgagaggtgaaattcattgaccctagcaagacttaccaaaagcgaaagcagtggctaggctatactctttgtgcttgcgcaggtgattacatattttcttatcgcagtcactcacacacatacatacacacactgctgcagcagaaatatatgacaccacagcgcattacactttcaatgaagaacgaaggttggggggtcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctagcaactctgttgcgctcgcctgactattttcgtacggtctcgaatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaccataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatatctttggatatttcatctgtcgtgttgtaattaacactttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatagctatatgcttatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatttttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttacttttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggcttgcacacgtgctacaatgatttattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatattttatatattgcacacctatggaaacttaaacgaacagtgtggtctagaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 9

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 9
Collector Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 19m
Description Agamont
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

>Nummulites venosus | genomic DNA | 9 | sediment sample | taxon:159862 | single cell, Agamont | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgcatatcactatttatgcgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacggtgcactaatattctaattattactcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattggcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccattttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI