Specimens found in “Black Sea, Crimea, Balaclava Bay” (25)

Specimen 10098

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10098
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10098.1 | genomic DNA | 10098.1 | sediment sample - Tile Hole | taxon:859211 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgcctagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10102

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10102
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10102.6 | genomic DNA | 10102.6 | sediment sample - Tile Hole | taxon:859206 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10110

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10110
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10110.12 | genomic DNA | 10110.12 | sediment sample - Tile Hole | taxon:859213 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgctttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgcttccccgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10111

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10111
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10111.17 | genomic DNA | 10111.17 | sediment sample - Tile Hole | taxon:859207 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggacgccttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctacccttgtggtatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10112

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10112
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10112.22 | genomic DNA | 10112.22 | sediment sample - Tile Hole | taxon:859208 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgtactttattgtgcgcggctcagcttgacctgcatggagtgcgaactagagggaccgctgatagcctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

Specimen 10127

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10127
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10127.37 | genomic DNA | 10127.37 | sediment sample - Tile Hole | taxon:859212 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgtactttattgtgcgcggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10128

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10128
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Psammophaga sp. 10128.42 | genomic DNA | 10128.42 | sediment sample - Tile Hole | taxon:859209 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctacccttgtggtatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. 10128.41 | genomic DNA | 10128.41 | sediment sample - Tile Hole | taxon:859214 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggacgctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10131

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10131
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10131.46 | genomic DNA | 10131.46 | sediment sample - Tile Hole | taxon:859210 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgctttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgcttttgcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10139

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10139
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10139.3 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcccttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcgacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10139.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacctcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10141

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10141
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.2942, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10141.4 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggagagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10141.3 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcagctcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10144

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10144
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.3 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgacgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggctcttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacatgccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtatgactatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaacctcaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagctaacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttgggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10146

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10146
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10146.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgatacgtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtatttgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10147

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10147
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10147.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcggacagaccattgtgcttaatattggtctcggtctcaactaggaattccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10148

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10148
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10148.2 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatacttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaaacacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtaccccccccccctcgctcttaccgatggactactctgtgagttggagggactgaccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10149

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10149
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10149.2 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgttctgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10150

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10150
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10150.18 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgtctggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10150.17 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgtctggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10151

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10151
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.50 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.47 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaaccaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.48 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10153

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10153
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10153 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgttgagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcgtttttttgaaacgctatggaaatctgtgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10154

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10154
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.25 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgctttcgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacgatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.22 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgctttcgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacgatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.21 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagaaggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcgattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctgttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10165

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10165
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10165.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10165.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaatagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10167

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10167
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Vellaria pellucidus | genomic DNA | 10167.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagacttgagtttggtgttttgttgcttcggtaacgttacaccactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10168

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10168
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.3 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcacttccgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcactttcgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggcaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcacttccgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10169

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10169
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10169.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcaggattgtgtgataggtggtgcatggccgctcttagttcgtggagtgatctgtctgcttaattgcgtttcacagagggctctttaatttctatctgttgcgcagcacctcgttgtgtttgtcgcacggtagatcaaaaagccctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctggttaacttcggttccaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttactaagactcgagtttgtgtttagtgcttcggtactttacacagctcggtcaccgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatcccatgcttgcatccgtgctcttggcttgtccttgagtattgtttggtgccttgggatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtccttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10169.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacagagggctctttaatttctatctgttgcgcagcacctcgttgtgtttgtcgcacggtagatcaaaaagccctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctggttaacttcggttccaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttactaagactcgagtttgtgtttagtgcttcggtactttacacagctcggtcaccgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatcccatgcttgcatccgtgctcttggcttgtccttgagtattgtttggtgcctgggatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtccttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10170

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10170
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10170.51 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactaaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10170.52 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

Specimen 10172

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10172
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10172.58 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10172.59 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI