Specimens found in “Southern Ocean, Weddell Sea” (24)

Specimen 3213

Species "monothalamids" > Clade C > Rhizammina > Rhizammina algaeformis
Isolate number 3213
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Rhizammina algaeformis | genomic DNA | 156 | taxon:525823 | small subunit ribosomal RNA ctcaaagattaagccangcaagtggntcttacctgacggtttgaataagtgttctcgcatagatttgatcagtttttgttccgttcatttctattctatttctgtcttttttacattgnctcacattcacttgtgcaactgcagatagctgcttaatacagtctcacttgtcttgacttggcattcgtttgctattcacatttcttctttctctctctctctttctaccatgtctgtgaaagcaattttggtgtgttcgcactgttaacacttcctactggataactaagggaaagtttggctaatacgtacgagantcacttttctcttctctcttctctcttctctctctctctctctctctctctctcatttgcacttattggtttgtggaccggatctttttgtatttctggtttcacagtagcctcatgantgacaataagaacgcactaagcaatctttctgagattgttgctgagcagacttgcaatcatctttttgcaagcatgtcatacaagcatctacagcatcaagtcacagngttggcaagtgtctttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagcctcttgtggacttatcatcttggacaagataaaacaaaactgattcgaattttccgttgaatgctttttgcnttcgtggtcttattcttcttacttctttctctttctctctctctctcttattctttatttctgtcttgttgacaccttcttgtttgacgatttggactggctcgttcacacgagttggtctgatcctttcattgaggcagtgacaagctgtaanttttgagtatgcttaaagaacgggtgtgtagacactgtcacttcgtgattcgtgactccgccnaatatgtgctcatttggnatgcggtgaatttaagtcattcggagtgagtggtgtccttgtttggacatcacaaacatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttaatatgaaaacaaattttattctttttaatagaaatagatttgccttttttttattatacgacatacaattttacacacacatttatttttattatcatcattcttttttatttttcaacactgtgaacaaatcagagtgtaccaaacatgtcgttttacgataagtgcattgaatgtttcatcatggaatgttgcacttctaacatttttatatgtatatttttttngtcatttagttacactacacatttggttaacgtggcaataaaaggtatattattataaaaatatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgaatattttcctttttaaattattacacacactattaattnttttaaatggaaatttcccactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcatatacttttgaatgctattgccctcaacctgcaaaaattttgtggttcgagcttatgttatatttttatgacacgctcacctatttattttagtacggtttcgacggacatttcatttatatattttttgcgtgtaagtatttttaatattgcttgaaacattagcaatatgtgcctgcacatgattttctgagctttgcgctcatattatttggtgagatgtaagcactagacgtgggctactttcagcggctgtgcgcaggtattaatttatcgccgtagctttgtttgattgttcagcctttcgttattttaatggtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 3334

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3334
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.23

Barcode sequence

SSU partial

>Foraminiferan sp. W79 | genomic DNA | W79 | taxon:212481 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI

Specimen 3338

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3338
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3338 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3339

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3339
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3339 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3409

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3409
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3409 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA aatcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3437

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3437
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3437 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA ggaaacttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3476

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3476
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3476 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA ttaccgggtccggatacactgaggattgacaggcgcttgtagttataagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttaaaatagcgtgtgcgccataatttcggttatgtgctgcctgctgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttataatttaattttattattaaattattaagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttaatatttatattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgatgtaaccttgcataatctctcctttttggagggtgcatgtattgttttgttaccttgggacatgtgctccattaattcttgttggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3477

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3477
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3477 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3487

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3487
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3487 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA atcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3553

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3553
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 6326m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -58.5, -23.58

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3553 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattatagcactgtagtccaactagtctttttctgtttattcaggatttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattattaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3623

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 3623
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 3623 | J. Pawlowski 3623 (UniGE) | taxon:349561 | small subunit ribosomal RNA gattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgc

See sequence on NCBI

Specimen 5127

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5127
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5127 | seawater, depth:4654m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tttgactcacgcgggaanncttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5149

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5149 | seawater, depth:2167m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5164

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5164
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5164 | seawater, depth:4407m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttctgtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5174

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5174
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4526m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -70.31, -14.34

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccctagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtcttttgtgagcctkgtatttctttttttagtttatacatctcagttngnctkcgttttatgggagtgtgtttgtctttttatatttattccgcttttngcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgntaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtcyaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 3 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggkgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccacatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 5191

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5191
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5191 | seawater, depth:4803m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA atttgactcacgcgggaaancttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5222

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5222
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5222 | taxon:349561 | small subunit ribosomal RNA caagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttatacacactcacgcacacacaccatacgattttgtttacggtagtaacaatttcagcgtgaatcacttcttacacgcagtgaatcactggaatttacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcattttaaaaatttccttattcggaacacctgctcgcaggcttacgggtggatttttttatatcgacttttgtcgtgcatacccacgcatttcaaaattcattttgatttctctgtatcgcttattctctaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtacatataccacacacacacacacacgatacaaaatttattttgttttgctgcgtgtatcgacacaccacacacacacacacacacttactactcagcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttccttcgggagcttcacatcacgctgagcagactttgcgaagtttacttcgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatctatttataaattgtaacattaccatgcgttaacaatttacaacataacaagtttattacacatatagcactatatttttttctgtcacacagagaagacatccttgttcgttgtttattcagcatataagctattattttatattagttttttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaatttgaatgaattctcgtatccattctattttttgttatagttttacgcattatcaaattcacgtttgtattttgcgttcgacgctcgttaaaaatttacacacacacacttttttttttacgcggcactcgaatttttaccgtagcgtatatacgtacattctacacacacacacttatttacgtatatatgcactcacgcggtaattatttgagagaactatatcactcgcttaaaatttattctcctttcaacactgtgaacaaatcaaagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcacttccgccttaaagaaaattattgcaattttttcgccacacacacaccatgcgtacatgttatatatatttcgcagccacgtaaaattctgttattttctttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatgcgtataagagtcacacgtatatttttttacacacacacacacgcacaaaaattttatacgctctctctccattacgcatcaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtatggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactgcccgcagcgtataccctcgggtatttcgtctgtcgtgtgcagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 5226

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5226
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5226 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacraacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 5412

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 5412
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on August 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 5412 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA taccgggtccggacacnctgaggattgacaggcgcttgtagttataagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttaaaatagcgtgtgcgccataatttcggttatgtgctgcctgctgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttatttcataatttttaattattganattggtttatanaggctaactanagggaccgctgacnacttttanaacanangaaggttgcngcaataacangtctgngatgnccttanatgttccgggctgcgcacgtgctacnatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcattttttgattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgatgtaaccttgcataatctctcttttttgagggtgaatgtattgttttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 8352

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8352
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 4 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtccttttgagcttgtattgctttttctagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattagtgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagtttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgcgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggagtgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtctgagggactgggttgcagttttttttatattctgcaaacacctgcggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8353

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8353
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 9 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggkggkgcatggccgttcttagttcgkggagkgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcgcacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttataaatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgnacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 8 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatctttccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8356

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8356
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 16 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtatacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttatttcttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttatgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 15 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8357

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8357
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8357 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 22 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8360

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8360
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 30 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacncttctcataacatangaggntttccnaaanctnnngggnncgctgcgacttttttaaaccagaggaaggttgnggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatngcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacnagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattgnaagtaatgatttccctttctctttttttattacatatatatttttttgnganttctttaattaagcnagcacannatatgtctnntctcncgccctgnctgnngnnntttgtagttttntttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttagaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctttggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 29 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacattgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI