Specimens found in “Antarctica, Explorers Cove” (11)

Specimen 1082

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 1082
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 1082 | taxon:162490 | 6 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacgaacgtgaccgcagcctcttgttgcctcccttgtgcatgctgcattgtgttttgtggtagtgttttcatttttaatgaattcgccatgttacgctttcagttttgccacagttttttcaactgtatgtattatcttatgcctgtntggtgttttagagttgcactatgcgtatgtggttgctacaaatggtgatcgtgtgcgtttgtgtgacatcttggcgctgcttttagggtatattgcatgtgcgtacaaagaatttatctgcagtggagggaaactagagggaccgctgactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagtttcagttacactgatactttaaagggtattggttgtgtgttgaaggttttgcctttatacgcatggcttttacctgttggtgttagctggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatatnttatatatgtcctgtattttaaggctgttttctcttttagagattacaatttacctctattatacggtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgttttcaactaggagtgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttcactgtgagtttgagggactggaaaccctttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1087

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1087
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgccacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | 1087.4c | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggagacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaagga

See sequence on NCBI

Specimen 111

Species "monothalamids" > Clade I > Astrammina > Astrammina rara
Isolate number 111
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina rara | genomic DNA | 111 | taxon:46078 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA tctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttactttttaattaagtttatatatattatatatattatattattattataaacttttttaattaaaagtgatatataatctttgatttttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaaatgtttatatttaaggtgtttttatatatatatttatatatatttaaatgcattttaatatataaacaaaatatgttactttaaagagcaataatattttatatattgttgttttttttggataactaagggaaagtttggctaatacgtacgagttaattagaattatattaaatttaaaatgatatatatatattatttatatatattgttttatttttattattatttcattattactttttgcacatattggagcagtgaagtattatatatatattatttatattgttatatgtattatacatatatatgttatccttttaactaagtgaaaatatgtattgtatatatatattcaatattaagtataatgtttaatactttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaaaatgtaattattattaatatataatttaattattatatattgtatttttattattttaaagcatgctttatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacggcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtccccttttattatatatatttaattatgtgtataaacattgtgtgtaatttgcatatttaatttataaattatatatatatattatatataatttaattaaattgtaaatacgaacacttggttttcaaactcaaaaaaaataaaaataaagaacaatttatttacattccttgttatattgtttctcttttatttttaatatagatatattatatatatatattaattttactgaggcagtgacaagctgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttctttgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtctttacggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttttttattaatttttgatataattatgtatatttatttatatatgattatattaaaaaattaagctgagatttttaaataatatatttatatttatatttaatatattgtttgaaaaatattcaagttgaatttgtgttattcaaattcatatttttattttaataattgttgttttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcgaatatattatatatatgtatatgatacaatcttaattgaaaataaaattatgtatttttatattatgaatgaatacttttttgttttaaaacaatatttatatgtatatatatatgttttgaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggcgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgatttatatgtatatatttatatatatatattatattattgttataatatatctttattataatagtataaatgtatatatatttatatatatatattaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaatcagggcttgtagcgttgttttatcagtttataaattttttatataaatgattattttattataattattttgtttaatattgttagattgttcaattgctcgcctgtatttgtatacggacttgaaggcattttttgcaagcgtgcagcattcttttaaaatgttattttataatattataaattttatttatatatatttattatacctttttatatttatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagacgtcttatagtttgtattatttttgatatatatgtattttcttcatagtaatattaatattgaatataatttatcaaactaacttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 118

Species "monothalamids" > Clade I > Astrammina > Astrammina triangularis
Isolate number 118
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina triangularis | genomic DNA | 118 | taxon:46080 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttacttttaatttaaaaagtttaatatatgtatattaaactttttttgttttaaaagtgatgaaaattcagtttgtttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaatgtttatgaattggggttatatatatatttatatatatataattttaatttatgaacaaaattgttactttaaaagataataatatattttaatatgttgttgttttttggataactaagggaaagtttggctaatacgtacgagttatttgaaatgttataatataattatatcttttaattatattatattatttttttttactttttgcacatattggagcagtgaagtattatatatactatttatatttgtatttatattaaattgtgttttacatgatttatatatatatgaatttcatgaatataatatttaatgctttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaattattatattaataattaatatatatcatgactttattgttatgtttatatttttatttttatatatatttattacatgctaatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacagcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtcccctttttatatattaattatattaaaagtttaaacattgtgtagttttgcatctttttttttatatttatataaaaaacaaatataaaattaaaatgtaaatacaaacacttaggttttcaaacaagattattaaatgttataataatattacattccttgttatattgtttctcaattaaaaattaattcattatttaattaatatattcttttttactgaggcagtgacaagttgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttcttctgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtcttcggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttatttttttattaatttttttattataattatatatttatatatgattattttaaataaaattaagctgatattttaaattcaatattatataataatattagttgatttaaaattgaaagttttaattataatatgattaattaatttatttaaaacacgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcaaataatatatgtatttatattgatactacttttattaaattaaattaaatttaattatatattgattctttttgatttttttaatataataatactgtattaattaattattttaatatgtatattttattttaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgattttgattatttaatataaaagatttgtatatatatatatttatatttatatatataaatttaatatattaataattaaaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaattcagggcttgtagcgttgtttaatcaattttattttgatttacttttattaatataatataaatatttattatttgtattttttaattcaattttaattaaatttttaattgttcaattgctcgcctgtatttgtatatggacttgaaggcattttttgcaagcgtgcagcattctttgaaatgtttatattaaatttaattattttattaattataatttctttatatcgttttatattatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagatgtcttataacttgtgcttaattatttgattttaatgttttcttcatagtaatattttaattgatttaagcgtaagttagcttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1188

Species "monothalamids" > Clade C2 > Gloiogullmia > Gloiogullmia sp.
Isolate number 1188
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Gloiogullmia sp. 1188 | genomic DNA | 1188 | taxon:164091 | 11 | single cell | Sweden:Tjaerno | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatcgtttttatcttttaaaacattcgcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcatactggacttagaaatcaagtgtgtttatttttcttgtgcggttatgttttaatgcattttgttaccccatttttttgggtgagtttcaatttgtgttttacattccgtgctttattgataaataaatacacatctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaaaacatttttttttattttttttactttaatttcttgttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacagcactgttttcattttttttttaaaatgagcagtcaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaatttatttttgattttgtgagcacacaatatgctgctcccctccctggcatttagctttttgtctatttgtcattgtgtgtggggatgctcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagttttttttattttttttttaatttgaaaaaagctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1225

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 1225
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 1225 | taxon:159871 | 19 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacgaacgtgaccgcagcctcttgttgcctcccatgtgcaaactgcattgtatttctgcgtgttgtactttagggtataatatgtgttatgctttcggtttttgccacagttttttcacttgtattcatttcgtatatctttggtgatttgcgaagactacttggatttatatttgtgttatgtggtcgcttcaaatgcggctatgtacacttttgtattttccttgtatgtctctctgttgcttttgagatatatttgtttatgtgtacatcgaaattatctgcagtggagggaaactagagggaccgctgactctttataaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctacccagttcgtgtgcacagtttttcgttacattaatactttaaagggtatatattatgcatgtgttggtggcgtctttcgctagatgccctgatatgtgtgtgtgttgcctgttagtgttagcgggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatattttatatatgtcctgtattttatgggtgttttctcttttcagagtttacgtctccgtattattcagtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaaactccttttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 1994

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1994
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1994 | taxon:324130 | small subunit ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttttttcattccttcgggtatgttaaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggngcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaanaaagctttttaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgnacncctatggaaacttaaacgaacag

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1994.4 | J. Pawlowski 1994 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctacattaacccgacagtttaaataagtgttcatgctatcacgcataacatgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattagcataaattttgtttacgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacacactcacacgtatacactactcagcactcartggtaaactttgatttacgcgtattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgttcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgcacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacacacatccttgtccacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagt

See sequence on NCBI

Specimen 2112

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2112
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2112 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Explorers Cove | 77.58 S 163.51 E | Nov-1999 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaaccaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggactcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccactcggaatatgtccctgccctttgtacacaccgcccgtcgctcttatcgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 2114

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2114
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2114.5 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, New Harbor, Tile Hole | 77.34 S 163.3 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaacttttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattacagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgttggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 340

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 340
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 340 | taxon:162490 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacga

See sequence on NCBI

Specimen 343

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 343
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 343 | taxon:159871 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacga

See sequence on NCBI