Specimens found in “Antarctica, McMurdo Sound” (5)

Specimen 1145

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1145
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1145-4b | taxon:324130 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttcatattccttcgcgggttcgtgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1145-3 | taxon:324130 | small subunit ribosomal RNA ggcatattaatatatacttttttctattccttcgggttcgtgttaaatgtctatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccattcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgatattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacatattaatttctgtgcaagaaagcttattaaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataaacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaattgaattatttgcaagtgaagcatctcatatatatatatataacaccgcatgcgcgagtccatttattcagtttctctacccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacc

See sequence on NCBI

Specimen 1148

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1148
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.56 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgctcgcgcattcagtataaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacgggagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtattcacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgtt

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.2b | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctggttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaagccacccggaatacgtccctgccctttgtacacaccgcccgtcgct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.57 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcnnnnnnnnggctcgacgttggattgaactgcaatatgaatgaattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaatttttcctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacacacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatggcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgccgtaaatattttctcacacacacacacacacacacgtacatgtttacatagcccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactcttttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcgacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagctgcttcgaaagtaagtgggtaatcaattagaagtaatgaatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | 1148.1c | small subunit ribosomal RNA | s14-sB region cactgaggattgacaggcaatattagtacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttacagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcgattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacg

See sequence on NCBI

Specimen 1850

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1850
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.4b | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaagaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgaggga

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.26 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.7 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattcggccgcactagtggatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcgagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaattttttctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacgcacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcatcnctgtgaacaaatcaagtgtatcaaacatgtcrtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgacgaaaatattttctcacacacacacacacacacacgtacatgtttacatagccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcactcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattcttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 2187

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 2187
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 2187-1 | taxon:324130 | small subunit ribosomal RNA agaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttgcattccttcgggtatgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttanttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacntatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattangtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactanagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcnntttctctaccttcacgggtatcgctgttttaaatgtgtatctctccgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgattcctttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttacttttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaacacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 2187.3 | J. Pawlowski 2187 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcattgctatccgcataacacgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattaggcataaattttgtttgcgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacacacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacactcacacatatacactactcagcactcaatggtaaactttgatttacgcatattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgtctcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacatccttgttcacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI

Specimen 2976

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2976
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.7 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgatgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.6 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagtcgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI