Specimens found in “Japan, Amami-O-Shima” (3)

Specimen 27

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 27
Collector Johann Hohenegger
Collected on March 2004
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 27 | sediment sample | taxon:196924 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcacactttgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatcttttttataagattacgctttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgccgagtctatttattcaccttaagtgtgcttaaatatgtatctctgcgcgcggtaaagcctgtttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 3
Collector Johann Hohenegger
Collected on March 2004
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtatttgtttgcttagcacatacaattaggaccagaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacgtttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Heterostegina depressa | genomic DNA | 3 | sediment sample | taxon:196924 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattatacgagattgcttacggtagcaacgatttcagcgtgaatcacaccctacagtgaatcactgcaatgaatttcattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattatatgatattcgcgtatcatatatatatactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatcacacacatacacatacacatacaccaatgtatatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcaccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcctcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacacacatacactgtgtgcagcatatataacacattatatttattctgtcacccgacagaacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacactacatgaatgaattctattcgttctgcgtttgatagttttacgtgtcacgtattttatacgtttcgcgtatcgacgctacctaacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttattatactagcacactcgctctgctgtatcgcaacacacacatacacacccacactgcagcaactgagtgatcagtatataccatttacgtcatggtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatacgctgcgcataatattcacacacatacacacccgatgcagcagtggtaagcttactatacgctatgtaaaaaattcataacggttataaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgattaatcattatatgcacatgcagtcacacacatacacgcacacttctgcagtagtgacatataatatatattacattaccacacagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaattatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgtgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtatttgtttgcttagcacatacaattaggaccagaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacgtttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 42

Species Rotaliida > Nummulitidae > Planostegina > Planostegina longisepta
Isolate number 42
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgactttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaaccaccgttgcacgtaaatatttttcattacctttgcttccgtgcaaaaaggccttttaaactagagggaccgctggttactttcttaaaccagaggaaggttgccggcaataacaggttctgtgatgcccttagatgttccgggctgcacacgtgctacaaatgattattgcagtgagcatctcatttaatcacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planostegina longisepta | genomic DNA | 42 | sediment sample | taxon:311574 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccatatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcttatgatacgcatacactgtatcgtatcatacatacactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattcacacacacacacatacacatacactcatcaatgtatatgtgagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcacatgagagacatttgagcacgcacgtgtcgtaacttcgggtgcttcacatctacgctgagcagacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacaagggttggcaagtgtatttttgaaccttcaaagaagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccagtctaactattagatagaggtgtgcagcatatataacacaatttattctgtcacccgacagaacatacacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcgttactttacgtctcgcgtattcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttacacatgtcacgcacagacgcttacagtacacacatacacagactgtagcgactgagtgattaactatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatatgcattgaatgtcttatcatgggatgttgcactttcagcttgttaagaattattacgtacattacgctgcgcttcatacacatacacacccgctgcagctctcgtaagcttatacgctatgtatgattcataacggtttaaaatggccgatgggggataagttggagtccaccagtactgctggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatacttctttgggcttgcgcaccgtgaccccctgagatacgtaaagtctcacgctgtcatacacacacacacacacacttttgcagcaggagatatataacccacgtatcaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaaccctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcttacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttgctttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgactttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaaccaccgttgcacgtaaatatttttcattacctttgcttccgtgcaaaaaggccttttaaactagagggaccgctggttactttcttaaaccagaggaaggttgccggcaataacaggttctgtgatgcccttagatgttccgggctgcacacgtgctacaaatgattattgcagtgagcatctcatttaatcacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI