Specimens found in “Pacific Ocean, off Japan” (5)

Specimen 6929

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 6929
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P6929-22 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtagagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P6929-21 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccatatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7180

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7180
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7180-12 | taxon:349561 | small subunit ribosomal RNA taatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtct

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7180-11 | taxon:349561 | small subunit ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacggacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgnacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcgtacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

Specimen 7565

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7565
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1990m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.49, 137.08

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7565-21 | taxon:349561 | small subunit ribosomal RNA tcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7565-22 | taxon:349561 | small subunit ribosomal RNA aacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggcggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttnttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgnggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 7566

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7566
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7566-33 | taxon:349561 | small subunit ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaag

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7566-31 | taxon:349561 | small subunit ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgtttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacanngnggtctaaaggaaagagnagtcgtaacaaggc

See sequence on NCBI