Specimens found in “Antarctica, Ross Sea, Terra Nova Bay” (4)

Specimen 3790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on January 2003
Habitat soft sediment
Location Antarctica, Ross Sea, Terra Nova Bay

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Terranova Bay | 74.4 S 164.04 W | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3791

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3791
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3791 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtgatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3792

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3792
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3792 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatctaccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3804

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3804
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3804 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttcccttgactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI