Specimens found in “Scotland, Loch Linnhe” (1)

Specimen 2281

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon alba
Isolate number 2281
Collector Tom Wilding
Identifier Tom Wilding
Habitat soft sediment
Location Scotland, Loch Linnhe
Latitude, Longitude 56.3205, -5.2725

Barcode sequences

SSU partial

>Toxisarcon alba | genomic DNA | WC18H | taxon:164134 | 12 | single cell | United Kingdom:Scotland | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgacccaacgcgggaaatgttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagctttttgactagaattttttgattttagttttaagaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggacattttgccttgttctttgcatttgagttgcttttagtgagttttaacgtttttagtttgttttaccccagtttcggctgcgcgcgtaactttcttttttaaactattgcttcaagttttaatttatttgtgaggggctcatggtgaaattctgctatttattgggagaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaactattaagctttaaatttcttttttcattaagagatttttttagccagttttaacaaagtaggctctattctcttcattaaaaacaggggaataaaactaaagggaccgctgcgactttttttaaaccagagaaggttgcggcaataacaggtctgtgatgcccttagatgattccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgttatttatagatttttcgtagctttcttttttctatatggactttattgtctgtgtggagaggggaaggttatggatattttacaatcagtaaattccagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttatatcaaaatttattttttggttttgcgagcacacaatgtgctgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttcctgactttttttataaacaaaaaaacaaggaatttacagtgcgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctttgtcggttaggcggtttttattaactgcttctgacactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcngtaggtgaacct

See sequence on NCBI

SSU partial

>Toxisarcon alba | genomic DNA | WC18H | taxon:164134 | 11 | single cell | United Kingdom:Scotland | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccaccaggagtggagtctgtggcttaatttgacccaacacgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagccttttgactagaatttttttattttagttttaagaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggacattttgccttgttctttgcatttgagttgcttttagtgagttttaacgtttttagtttgttttaccccagtttcggctgcgcgcgtaactttcttttttaaactattgcttcaagtttttaatttatttgtgaggggctcatggtgaaattctgctatttattgggagaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaactattaagctttaaatttcttttttcattaagagatttttttagccagttttaacaaagtaggctctattctcttcattaaaaacaggggaataaaactaaagggaccgctgcgacttttttaaaccagagagttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgttatttatagatttttcgtagctttcctttttctatggactttattgtctgtgtgagaggggaggttatggatattttacaatcagtaaattccagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttatatcaaaatttattttttggttttgcgagcacacaatgtgctgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttcctgactttttttataaacaaaaaaacaaggaatttacagtgcgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctttgtcggttaagcggtttttattaactgcttctgacactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcngtaggtgaacct

See sequence on NCBI