Specimens found in “Svalbard” (6)

Specimen 2632

Species Robertinida > Robertinidae > Robertina > Robertina arctica
Isolate number 2632
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2001
Location Svalbard

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Robertina arctica | genomic DNA | taxon:551669 | 18S ribosomal RNA rbrtnactcaaagattaagccatgcaagtggttataataacccgatagtttaaataagtgttataaattttgagaatcgcttcaaaaattgtactttaaacacacctcttttgacgattcagagcaaaatttcggatgataacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgactttggcactcgatcaaatcatctttgattcatacactcactgggccagaactaacacttacagtcacctgtttttgtcttctgggttccctttattgaattatcgatgtttttgtttgatacgacaaaaagatttctctgtagcggttcttatattttttacgaaatatttcgacgttacatcgtgcattttacttttcggataactcagggaaagtttggctaatacgtacgagcatctttaatcttacacacccacaccactctctgcacaacgagaaaagatcttttactcagcacttattggtaaatgtttgatgcgctttcgagtgcatctttcaacatttaaaagcaacatgagagacaataagtacgcaggattgggcatttcttgtcctttccatacgctgagcagactttgcgaagttcacttttgcgaagcaagtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagtaccctacaatatgtaataccatcattcacaaaattttttaacacacaattttctctgtcaactttaatccttgtcagactgaatcaattaattaaccttgtgaattcattttctcatattattttactgaggcagtgacaagctgtaacggttgagtataataatgacgagtgtctgacattgccgcctgcttctgtaggcttggcagtctgtcgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttgtaaaaagcattgttcttgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaactttaaaaacacaatttcaggtttcttcggatctcgttctgatgtaatacgcacacgtacccacgtcagcaacgttctttgcggattcttgtttttgatttttatttaccaaagtttgtagcacaagacactttgtctttttctagatgaagtgtgcttgtacgacgctgttaattgtattcggtcttgaatgacaaatatgatttgcagtctgatacacaaacgaaataaagatcttaccatttttatcgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcttttctaaatgtgcattgaatgttccatcatgggatgctgcacttttaacactttcttttcccatgttttgctaaccactcacactgtagctttacaaccgggtaaaacatgtgaaggcatgtgctatacttcatactgtcttttgaaaagaaaacagttataaatgtcgatggggatagttggagtcaagagtactgttgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgatgtcagtgtttgaagatacacgctactcgcgtatcatggttatttgcggagcaattaacgttagttgcgtattgccaactttcgagagattgttagagtgaacggcaacggatactgttgttgttatcgcatttattcattgatcgcaatttgcacttcattcatctggttacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttaaatattaattgcaaatgccctcaacctacaaaatattgaatattttcgttgcttgagctagtgtctttattgatacgctcgctttgaatttatttgttttcgtacggtctcgatggacgtttcgattaaaaaatctaattttttgcgtgtatgcattttgactttatcttcattgataattcattgcgtgcacttgattttcggagctttgcgctcaaattttggtgagatgtaagcactgtgtcattctacacgagaactttccgttcaatttattgttcggacttgcttcatcgtttgtagtctgatattttttcaaataggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 4643

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4643
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttattttcttataaaatatagttcacatataaatgatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataattttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaggtaatgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttgcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccg

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacctgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccaraggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcagtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgtttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccgcccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 4645

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4645
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgnc

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccaaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaanccacccggaatacgtccctgccctttgtacacac

See sequence on NCBI

Specimen 4724

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4724
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4724 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggcctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgagtaccttagtaacttttgttgctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4836

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 4836
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Location Svalbard

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 4836 | J. Pawlowski 4836 (UniGE) | taxon:313611 | small subunit ribosomal RNA | sA-s6 region ctcaaagattaagccatgcaagtggttacactaacccgacagtttaaataagtgttcaatgctttttccacatatatgatatatacggtctattcgttcacacatacacacacacaccacccgtgctgaacttagattccaacatatatatatatacacacattaagtgaatcactgaattctcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcatacgcgcaatgcatgaatatatacattacgtttcgactattttcgtaattgctcctttcgcctatgcactttacatggtcttccgtgtcgagtgtatctgcaccgggggtattttgtgaaatgcgtcaaatgtattcctattgaaatgcaatgcacggcttacctacacacacacatacacacactgtgatttctctgtttcgcttatctttatttcaaagattgctacgcgttacaccgtgacaacttcttttatttatggataactcagggaaagtttggctaatacgtacgagtatttacacacacacacacacacactctcacacagtgtatatatatatatattggttggtgcatacattttctcacacatcgtgtgtgtattcaaacagtatgtatatatatatgactccctctactcagcactcaatggtagacttttggtttcacgctctgcgtattccagtacaagtttaatcgcaacatgagagacattgagcacgcacgtgatttcgttccctcgggaacttagtcacattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattatatattgattattattatgcattatgcgcaaatttacaacatacattatgcaaatcattgtaacactacacacatacacaccctttttactctgtcatcatcatacatagcatatccttgttcgttgtttatttcagcattaaagcgtatatattattaacaccattatatacattcacttttttactgaggcagtgacaagctgtaacggttgagtatttaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttattctctgtaatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI

Specimen 4859

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4859
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4859 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttattttcttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctc

See sequence on NCBI