Specimens found in “Antarctica, Ross Ice Shelf” (1)

Specimen 4026

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 4026
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on June 2003
Habitat soft sediment
Location Antarctica, Ross Ice Shelf

Barcode sequences

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 2 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaattcgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggyttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgtgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggnttttaagtttnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcancatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcngaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 5 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgngtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttctttttatttttttaactttcaagtcttctggcttttcagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI