Specimens found in “Antarctica, King George Island, Admiralty Bay” (19)

Specimen 7763

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7763
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 20m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.37

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7763 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.37 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtngcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattrttgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactggctttctatttat

See sequence on NCBI

Specimen 7776

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7776
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.3 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtctagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagttatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.2 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggtacagacattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7784

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7784
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.4167

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7784 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatnagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7855

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7855
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7855 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggcttttaagttnnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7856

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7856
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7856 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttatttttttaactttcaagtcttctggcttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttnctttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7866

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7866
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7866 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttattttttaactttcaagtcttctggcttttaagtttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7887

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7887
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 107m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7887.1 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.34 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctttatgagtttgggggactggctttctatttatagncagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 7902

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7902
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7902 | taxon:1051365 | 15 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccctgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7905

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7905
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7905 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcnnttcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgaacaaggcaa

See sequence on NCBI

Specimen 7907

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7907
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaatcgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 28 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcctaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccaatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7909

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7909
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 31 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggtccaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 33 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtacgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgwacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7918

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7918
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7918 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.06 S 58.19 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7931

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7931
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7931 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7962

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7962
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 21 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgcgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 23 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatataattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcaataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7963

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7963
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7963 | taxon:1051365 | 39 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctctgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7964

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7964
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7964 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaanagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttanatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8010

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8010
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 108m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.29

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8010 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.29 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 8149

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.04, -58.21

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8149 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.04 S 58.21 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctngtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI