Specimens found in “Mediterranean Sea, 3PP cave, France” (1)

Specimen 4076

Species "monothalamids" > Clade C5 > Marsipella > Marsipella sp.
Isolate number 4076
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2002
Depth 60m
Location Mediterranean Sea, 3PP cave, France

Barcode sequence

SSU partial

>Marsipella sp. 4076 | genomic DNA | 4076 | taxon:1051378 | 1 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacgcactgaggattgacaggtgatatagatcttttcactttgtgtgattttttctaaataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaatggacttagaatttttatgtgtgatgctcgggcgttgtcgggtgtttgcttttttgcatttatcccttcatttctgcccttgtctttttttcacacgtctagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttaacttgattcctgatctctttctttctgactgagttcatttgcgtttcataacataagagtgctttcataaaactagagggaccgctgcgactttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattcatttattatctgactgctgctctttgagttttgcatcagataaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttttattattatgcactttctttttgatttgtgtatagtatgagcacacaatatgcggctcccctccctggtctttgattgcgattttaccgtctctcttggccattgtgtgtggggatggcctgtaattatgcaggcacttttacctttccgcatgtgctttttgtcaattcatggtggggacagaccattgtttatattctttttcttttatttgtaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacgaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatagtgcgatttgatctcacaacatctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI