Specimens found in “USA, Florida Keys, off Key Largo” (1)

Specimen 39

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 39
Collector Pamela Hallock
Collected on March 2004
Habitat soft sediment
Depth 18m
Location USA, Florida Keys, off Key Largo
Latitude, Longitude 25.06, -80.43

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 39 | sediment sample | taxon:196924 | single cell | USA:Key Largo, Florida | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattggcaatgagcatctcatttttacacacgcatgcgccgagtctatttattcaccttaagtgtgctttaaaatatgtatctctgcgcgcggtaaagcctgttccgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatcttttacccgggttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgtaaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaggggctgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI