Specimens found in “Rhone delta, off France” (1)

Specimen F277

Ammonia falsobeccarii F277
Species Rotaliida > Rotaliidae > Ammonia > Ammonia falsobeccarii
Isolate number F277
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on December 2006
Habitat soft sediment
Depth 60m
Location Rhone delta, off France
Latitude, Longitude 43.18, 4.45

Barcode sequence

SSU partial

>Ammonia falsobeccarii | genomic DNA | F277 | taxon:1004394 | small subunit ribosomal RNA ggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttatgtccttcgggactgcgtggctcaaagatgctagttctttcatgattatgtgataggtggggcatggccgttcttagttcgcggagtgatatgtctgcttaattgcgtatcaataatagagacctagtatacgtgcattactcatgtgggagtgaccccctcttcgcggaggcgcgtgtcgcacatatggtatgcgcactggtctcagatagcaacgaacgtgaccgtattctattgtgggagtgaattatacgtgttataccctcccggggtactcacatcccactgcttagggtgcgcggcgtatttcggtactcgcgtcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcgctgtgcatctaaccaaatgtgcgcggacgccccgatttgtgatttttgctttcgggcattattacatatttgcttgtgcgactgcgccgaacctacttcgaaagtaaaattttttagtgggtaatccattagaaataatgactctcataaaccatggcacactttatgtgcgcgcaggtctacccggctccctttgtgtgagtgcagggcgaacttgttgtttctacgtgccccccccctattaattcgtacgtggggatagacaattgtttaatttgtgggcctcgtcctaaacaagaatgccttgtacgggtctttggttcaacaaaccacccggaaaacccccctgccctttgtaaacacgccagcgctcttaccgatgggatatac

See sequence on NCBI

Other sequence

LSU partial

>Ammonia falsobeccarii | genomic DNA | F277 | taxon:1004394 | large subunit ribosomal RNA cgtataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatacaatatgcactacgtgcatactttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacaatacaaatatatgtatacgcacaacacacacacgctgggcgtgcttgatatagcttgtacacacacaccgcctctgcgatggaaagcatatatatatcttctttgtgtatgagatagagagtgacaccctcgattgactcacacatatatgagacacacacacacacacagacgcgtgcacgcnctatgtgttaactcacttgattctatatattt

See sequence on NCBI