Marsipella sp.

Order “"monothalamids"” > Family “Clade C5” > Genus “Marsipella

Original description of genus Norman, A., M., 1878, Annals and Magazine of Natural History, 5, 265-284
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Elongate agglutinated test, up to 6mm in length; sand grains, sponge spicules or tests of other foraminifers are incorporated in the agglutinated wall.

Representative pictures

Marsipella sp.

Specimens

Specimen 4076

Species "monothalamids" > Clade C5 > Marsipella > Marsipella sp.
Isolate number 4076
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2002
Depth 60m
Location Mediterranean Sea, 3PP cave, France

Barcode sequence

SSU partial

>Marsipella sp. 4076 | genomic DNA | 4076 | taxon:1051378 | 1 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacgcactgaggattgacaggtgatatagatcttttcactttgtgtgattttttctaaataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaatggacttagaatttttatgtgtgatgctcgggcgttgtcgggtgtttgcttttttgcatttatcccttcatttctgcccttgtctttttttcacacgtctagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttaacttgattcctgatctctttctttctgactgagttcatttgcgtttcataacataagagtgctttcataaaactagagggaccgctgcgactttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattcatttattatctgactgctgctctttgagttttgcatcagataaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttttattattatgcactttctttttgatttgtgtatagtatgagcacacaatatgcggctcccctccctggtctttgattgcgattttaccgtctctcttggccattgtgtgtggggatggcctgtaattatgcaggcacttttacctttccgcatgtgctttttgtcaattcatggtggggacagaccattgtttatattctttttcttttatttgtaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacgaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatagtgcgatttgatctcacaacatctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI