Bathyallogromia weddellensis

Order “"monothalamids"” > Family “Clade C2” > Genus “Bathyallogromia

Original description Gooday, A., J., Holzmann, M., Guiard, J., Cornelius, N., Pawlowski, J., 2004, Deep Sea Research II, 51, 1603-1616 (674 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The test is light in colour and approximately spherical to broadly oval in shape.The aperture is situated on a broad, low, moundlike projection with sloping sides and a slightly uneven outer edge.

Representative pictures

Bathyallogromia weddellensis Bathyallogromia weddellensis, 4000m Bathyallogromia weddellensis Bathyallogromia weddellensis Bathyallogromia weddellensis, 2000m

Specimens

Specimen 3334

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3334
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.23

Barcode sequence

SSU partial

>Foraminiferan sp. W79 | genomic DNA | W79 | taxon:212481 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI

Specimen 3338

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3338
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3338 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3339

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3339
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3339 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3553

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3553
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 6326m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -58.5, -23.58

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3553 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattatagcactgtagtccaactagtctttttctgtttattcaggatttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattattaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI