Vellaria zucchellii

Order “"monothalamids"” > Family “Clade E” > Genus “Vellaria

Original description Sabbatini, A., Pawlowski, J., Gooday, A., J., Piraino, S., Bowser, S., S., Morigi, C., Negri, A., 2004, Antarctic Science, 16, 307-312 (411 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Monothalamous organic walled foraminifera characterized by a wide, prominent aperture that facilitates attachment to larger particles (sediment or other foraminiferal tests).

Representative pictures

Vellaria zucchellii Vellaria zucchellii Vellaria zucchellii, aperture

Specimens

Specimen 3791

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3791
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3791 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtgatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3792

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3792
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3792 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatctaccctttactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3804

Species "monothalamids" > Clade E > Vellaria > Vellaria zucchellii
Isolate number 3804
Collector Jan Pawlowski
Identifier Anna Sabbatini
Collected on January 2003
Habitat soft sediment
Depth 25m
Location Antarctica, Ross Sea, Terra Nova Bay
Latitude, Longitude -74.4, 164.041

Barcode sequence

SSU partial

>Vellaria zucchellii | genomic DNA | 3804 | sediment sample - Tile Hole | taxon:859216 | Antarctica:Terra Nova Bay | 74.4 S 164.04 E | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA tcttaccgggtccggacacactgaggattgacaggcgattgtagtttttctatttatttagaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggatattttactttctattgagtcgcacggtctttcctcacggattgatctgttgcacttatagatgaaatcatcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatgagttcttatcttcccttgactttattgttttgggaatttggttctctgcatggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttcaagactttaatcttgtgtttgtattgtcctttacggggcaatcttacatagattagtcatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcttgttttgctgccgtgctttcagcttgctgttagtattgtttgtagccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagcgatttatcgcaagctatggaaatctacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI