Nellya rugosa

Order “"monothalamids"” > Family “Clade E” > Genus “Nellya

Original description Gooday, A., J., Anikeeva, O., V., Pawlowski, J., 2010, Mar. Biodiv., 1-14 (1.04 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Whitish test with darker (black and greenish) grains. Apertural end is broadly rounded and often more or less truncated.

Representative pictures

Nellya rugosa Nellya rugosa Nellya rugosa Nellya rugosa

Specimens

Specimen 10150

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10150
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10150.18 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgtctggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10150.17 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgtctggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10151

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10151
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.50 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.47 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaaccaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtatagtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10151.48 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttttttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10153

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10153
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10153 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggtgcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgttgagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcgtttttttgaaacgctatggaaatctgtgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10154

Species "monothalamids" > Clade E > Nellya > Nellya rugosa
Isolate number 10154
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.25 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgctttcgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacgatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.22 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgctttcgcatttgtcttttccctgcatttggagtttgccaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacgatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcaattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010a | genomic DNA | 10154.21 | sediment sample - Tile Hole | taxon:860579 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Nellya | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtagttcttctcttcggggttgttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaaggagccgttacgcccgttagttgcgcggtacttcggtgcctgtcgcactgcggggaaggtctcctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttcccttatgggacatgggatttgcttttgcttttgcatttgtcttttccctgcatttggagtttgccaactagaaggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaatttacacggctcggtttgtgtttagtgtttcgatactctacacatccggccaatcacctgtttcgaaagcaaacaggcaatcgattggaagtaatgatttcctttctcgcacatatttatgacccttgtttgtagccgtgcctttccttgtgttaggtatcgtttgctaccctgggttatgtgctccatttatttcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctgttaccgatggacttctctatgagttcagaggactggcttttcatttctttgaaacgctatggaaatctgtgcgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI