Psammophaga sp.

Order “"monothalamids"” > Family “Clade E” > Genus “Psammophaga

Description Gooday, A., J., Anikeeva, O., V., Pawlowski, J., 2010, Mar. Biodiv., 1-14 (1.04 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Test wall is brownish, more or less translucent and composed of fine grained material. Intracellular mineral grains are whitish to dark. Droplet-like shape with a bluntly pointed apertural end.

Representative pictures

Psammophaga sp., Black Sea, Crimea, Black Sea

Specimens

Specimen 10098

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10098
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10098.1 | genomic DNA | 10098.1 | sediment sample - Tile Hole | taxon:859211 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgcctagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10102

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10102
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10102.6 | genomic DNA | 10102.6 | sediment sample - Tile Hole | taxon:859206 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10110

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10110
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10110.12 | genomic DNA | 10110.12 | sediment sample - Tile Hole | taxon:859213 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgctttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgcttccccgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10111

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10111
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10111.17 | genomic DNA | 10111.17 | sediment sample - Tile Hole | taxon:859207 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggacgccttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctacccttgtggtatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10112

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10112
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10112.22 | genomic DNA | 10112.22 | sediment sample - Tile Hole | taxon:859208 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgtactttattgtgcgcggctcagcttgacctgcatggagtgcgaactagagggaccgctgatagcctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

Specimen 10127

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10127
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10127.37 | genomic DNA | 10127.37 | sediment sample - Tile Hole | taxon:859212 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttgcgtactttattgtgcgcggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10128

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10128
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequences

SSU partial

>Psammophaga sp. 10128.42 | genomic DNA | 10128.42 | sediment sample - Tile Hole | taxon:859209 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctacccttgtggtatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. 10128.41 | genomic DNA | 10128.41 | sediment sample - Tile Hole | taxon:859214 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgttttctgctctcgttagtaggacgctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttgatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgctttggcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10131

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10131
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10131.46 | genomic DNA | 10131.46 | sediment sample - Tile Hole | taxon:859210 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgctttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgcttttgcgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttttgttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI