Toxisarcon synsuicidica

Order “"monothalamids"” > Family “Clade C1” > Genus “Toxisarcon

Original description Cedhagen, T., Pawlowski, J., 2002, J. For. Res., 32, 351-357 (2.26 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The test is free, irregular, monothalamous with a central inflated region from which branches extend in all directions. The test is uneven, loose, very soft, flexible, and droops when picked above the water surface. The organism consists of a cell covered by a brownish proteinaceous organic lining to which foreign particles, detritus, small mineral particles or organic flecks adhere.

Representative pictures

Toxysarcon synsuicidica Toxysarcon synsuicidica Toxysarcon synsuicidica Toxysarcon synsuicidica Toxysarcon synsuicidica

Specimens

Specimen 1370

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon synsuicidica
Isolate number 1370
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on April 1999
Habitat soft sediment
Location Sweden, Kosterfjorden, Yttre Vattenholmen

Barcode sequences

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | Sweden:Kosterfjord | 16S rRNA | 16S rRNA | 16S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | 1 | Sweden:Kosterfjorden, Yttre Vattenholmen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI