Cedhagenia saltatus

Order “"monothalamids"” > Family “Clade O” > Genus “Cedhagenia

Original description Gooday, A., J., Anikeeva, O., V., Pawlowski, J., 2010, Mar. Biodiv., 1-14 (1.04 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Organic test, more or less lenticular. Aperture associated with short, delicate, transparent, slightly flared test extension.

Representative pictures

Cedhagenia saltatus Cedhagenia saltatus Cedhagenia saltatus

Specimens

Specimen 10141

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10141
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.2942, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10141.4 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggagagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10141.3 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcagctcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10144

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10144
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.3 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgacgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggctcttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacatgccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtatgactatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaacctcaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagctaacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttgggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10146

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10146
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10146.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgatacgtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtatttgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10147

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10147
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10147.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcggacagaccattgtgcttaatattggtctcggtctcaactaggaattccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10148

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10148
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10148.2 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatacttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaaacacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtaccccccccccctcgctcttaccgatggactactctgtgagttggagggactgaccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10149

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10149
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10149.2 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgttctgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10170

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10170
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10170.51 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactaaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10170.52 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

Specimen 10172

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10172
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10172.58 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10172.59 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI