Astrammina rara

Order “"monothalamids"” > Family “Clade I” > Genus “Astrammina

Original description Rhumbler, L. in: Wiesner, H., 1931, Deutsche Südpolarexpedition, Zoologie 12, 20, 53-165
Further reference Habura, A., Pawlowski, J., Hanes, S., D., Bowser, S., S., 2004, J. Eukaryot. Microbiol., 51, 173-179 (167 KB)
Description DeLaca, T., 1986, J. For. Res., 16, 216-223
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Large antarctic agglutinated foraminifera with a single giant nucleus (> 500um in diameter). The agglutinated test can be a transient structure.

Representative pictures

Astrammina rara, test removed Astrammina rara, test opened Astrammina rara

Specimens

Specimen 111

Species "monothalamids" > Clade I > Astrammina > Astrammina rara
Isolate number 111
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina rara | genomic DNA | 111 | taxon:46078 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA tctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttactttttaattaagtttatatatattatatatattatattattattataaacttttttaattaaaagtgatatataatctttgatttttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaaatgtttatatttaaggtgtttttatatatatatttatatatatttaaatgcattttaatatataaacaaaatatgttactttaaagagcaataatattttatatattgttgttttttttggataactaagggaaagtttggctaatacgtacgagttaattagaattatattaaatttaaaatgatatatatatattatttatatatattgttttatttttattattatttcattattactttttgcacatattggagcagtgaagtattatatatatattatttatattgttatatgtattatacatatatatgttatccttttaactaagtgaaaatatgtattgtatatatatattcaatattaagtataatgtttaatactttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaaaatgtaattattattaatatataatttaattattatatattgtatttttattattttaaagcatgctttatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacggcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtccccttttattatatatatttaattatgtgtataaacattgtgtgtaatttgcatatttaatttataaattatatatatatattatatataatttaattaaattgtaaatacgaacacttggttttcaaactcaaaaaaaataaaaataaagaacaatttatttacattccttgttatattgtttctcttttatttttaatatagatatattatatatatatattaattttactgaggcagtgacaagctgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttctttgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtctttacggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttttttattaatttttgatataattatgtatatttatttatatatgattatattaaaaaattaagctgagatttttaaataatatatttatatttatatttaatatattgtttgaaaaatattcaagttgaatttgtgttattcaaattcatatttttattttaataattgttgttttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcgaatatattatatatatgtatatgatacaatcttaattgaaaataaaattatgtatttttatattatgaatgaatacttttttgttttaaaacaatatttatatgtatatatatatgttttgaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggcgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgatttatatgtatatatttatatatatatattatattattgttataatatatctttattataatagtataaatgtatatatatttatatatatatattaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaatcagggcttgtagcgttgttttatcagtttataaattttttatataaatgattattttattataattattttgtttaatattgttagattgttcaattgctcgcctgtatttgtatacggacttgaaggcattttttgcaagcgtgcagcattcttttaaaatgttattttataatattataaattttatttatatatatttattatacctttttatatttatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagacgtcttatagtttgtattatttttgatatatatgtattttcttcatagtaatattaatattgaatataatttatcaaactaacttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtattatwatttataattttattattatattttattaatacgttatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccaaatagacttttctattgatatcagccttawyacttttgaatttataatatatatttaatcataattttattattatgtgccaatattattttatttttttttaaaggtaaggatttgattcaaagtaaaacgtggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatattaatatttaaaatgattttattattgttttatttattcttatttatatgtgttatgtatttgattgtatgtgaatgtatgttacatgtatttaatctgatgcattcattgtggttatatatatatatgtatttatacatgaatttattcgtgtattttatatatatatgtgattatagtgagtgttttggttttatacgtgtggtgtattttatttatatattttaatcattttatataaattgaggctaactagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagattattaaaataattatattatgaaaagtgtatttatttatattttgatttttatattatttataatttaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatataatataaaatttattttttatttgtgtttatttaaaattgatgcacacttttatgtctatgtttctatttttacatgttagaatattaatactatttattaatagtttaatttttaattttgtgatagttactgacatgtgctctcatattttaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttaagggactggtttgaattaatataatttttttagaaaatttattttttattattatattatattatattcaggctatggaaacttatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI