Astrammina triangularis

Order “"monothalamids"” > Family “Clade I” > Genus “Astrammina

Original description Earland, A., 1933, Discovery Reports, 7, 27-138
Revision Bowser, S., S., Bernhard, J., M., Habura, A., Gooday, A., J., 2002, J. Foram. Res., 32, 364-374
Further reference Habura, A., Pawlowski, J., Hanes, S., D., Bowser, S., S., 2004, J. Eukaryot. Microbiol., 51, 173-179 (167 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Species of Astrammina with flattened, polygonally-shaped test composed of a single layer of sand grains and containing an allogromiid-like sarcode. The test is delicate, variable in shape but typically with an angular, geometrical outline, the angles being projected out into short arms.

Representative pictures

Astrammina triangularis

Specimens

Specimen 118

Species "monothalamids" > Clade I > Astrammina > Astrammina triangularis
Isolate number 118
Collector Sam Bowser
Identifier Sam Bowser
Collected on June 1995
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Astrammina triangularis | genomic DNA | 118 | taxon:46080 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggtttgcaacccgacggtttgaataagtgttaatttacttttaatttaaaaagtttaatatatgtatattaaactttttttgttttaaaagtgatgaaaattcagtttgtttatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttcgcactgtaaatgtttatgaattggggttatatatatatttatatatatataattttaatttatgaacaaaattgttactttaaaagataataatatattttaatatgttgttgttttttggataactaagggaaagtttggctaatacgtacgagttatttgaaatgttataatataattatatcttttaattatattatattatttttttttactttttgcacatattggagcagtgaagtattatatatactatttatatttgtatttatattaaattgtgttttacatgatttatatatatatgaatttcatgaatataatatttaatgctttataacttaaatgttaagctgcattcatgcaacatgagagacaatatgtacgcgaacatacctttgttttaattattatattaataattaatatatatcatgactttattgttatgtttatatttttatttttatatatatttattacatgctaatggtatatgctgagcagacttgcgaggaatcatacttgcaagcaggtcatacaagcatctacagcatcaagtcacagggtcggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtcccctttttatatattaattatattaaaagtttaaacattgtgtagttttgcatctttttttttatatttatataaaaaacaaatataaaattaaaatgtaaatacaaacacttaggttttcaaacaagattattaaatgttataataatattacattccttgttatattgtttctcaattaaaaattaattcattatttaattaatatattcttttttactgaggcagtgacaagttgtaacagttgtagctttaaattaatgtaagggccttggatttgtcacttcttctgaagtgttacagagccggcttttacctgctcatctggaatgcggtgagtctaagcaattcggaacagttggtgtgtcttcggacataacaataatccgaactcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttatttttttattaatttttttattataattatatatttatatatgattattttaaataaaattaagctgatattttaaattcaatattatataataatattagttgatttaaaattgaaagttttaattataatatgattaattaatttatttaaaacacgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtatttgattgtgcattgaatgtcttatcatggaatgttgcaactcaaataatatatgtatttatattgatactacttttattaaattaaattaaatttaattatatattgattctttttgatttttttaatataataatactgtattaattaattattttaatatgtatattttattttaaatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcggtgaccctggcaagactaccaaaagcgaaagcacttgactaggctatcctctttgtgattttgattatttaatataaaagatttgtatatatatatatttatatttatatatataaatttaatatattaataattaaaaaacactttacaatgaagaacgaaggttgggggatcaaagacgatcagataccgtcgtcgtcccattaattacatcaaacgatgggcactcaattgcatattgagatattgtttgataatgccctcaacctgcaaaattcagggcttgtagcgttgtttaatcaattttattttgatttacttttattaatataatataaatatttattatttgtattttttaattcaattttaattaaatttttaattgttcaattgctcgcctgtatttgtatatggacttgaaggcattttttgcaagcgtgcagcattctttgaaatgtttatattaaatttaattattttattaattataatttctttatatcgttttatattatagtaatgcaagcacttgattttcggagctttgcgctcttttggtgagatgtaagcgacaaagatgtcttataacttgtgcttaattatttgattttaatgttttcttcatagtaatattttaattgatttaagcgtaagttagcttaaacggactctttactgttgtgaggcacgctttaggcacgcgcttactgcagaaatgtctgagtcattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacatactgaggattgacaggtgcaaaaatgtaatttattatattcatttataacatattacattatcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcataatagctccttatagacttttctattgatatcagccttaatacttgagaatgatcgtgttatatatatatatatatatganttaattttcgtatattatattatataattatgtgaattttttgagctaaggatttgattcaaagtaaaagctggagcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcattcttaatatgaatgatatatttatttgttttattacatttaaatgtattatttatatgtgttatgtatttgatagtatatgaatgttatgtgacatgtgtataatattatatatatatatatattatatatganatgatttgtattgttagaatttattttaatgatattaaattatattatatatatatgtgtatatgtggtttttatacgngttatatgattttntttatgtatttaatcattttgcataaattgaggnaaacgagagggaccgctaggctagctttttaaaacagaggaaggttgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcaacattgtgattttagtttattatgattatatatttatatattataatgtatttatttatgttattttatattatattaattgtttattctaaaaatttaatcacatagcctacttcggcagtcagtaggtaatcaattagaagtaatgatttccccttttttatttaaatgtatttcaaatttatttttttaatatgtttatttaaaattgatgcacacttttatgtctatgtttctattaacatattaggatattaatactatttattaatagtttaatttctaattttgttatagttactgacatgtgctctcatgttttattaaatgttcaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactggtttgaattttaaagtatatgtatatttatttatatatattactttttatataattcaggctatggaaactcatacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI