Leptammina grisea

Order “"monothalamids"” > Family “Clade C4” > Genus “Leptammina

Original description Cedhagen, T., Gooday, A., J., Pawlowski, J., 2009, Zootaxa, 2096, 9-22 (1.76 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Spherical body with finely agglutinated test wall.Test is coloured grey to violet-grey and opaque with non-reflective surface.

Representative pictures

Leptammina grisea

Specimens

Specimen 8356

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8356
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 16 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtatacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttatttcttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttatgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8356 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 15 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaacttttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttagtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8357

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8357
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8357 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 22 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8360

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8360
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 30 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacncttctcataacatangaggntttccnaaanctnnngggnncgctgcgacttttttaaaccagaggaaggttgnggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatngcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacnagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattgnaagtaatgatttccctttctctttttttattacatatatatttttttgnganttctttaattaagcnagcacannatatgtctnntctcncgccctgnctgnngnnntttgtagttttntttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttagaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctttggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8360 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 29 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacattgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI