Spirotextularia sp.

Order “Textulariida” > Family “Incertae sedis” > Genus “Spirotextularia

Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York
Further reference Hottinger, L., Halicz, E., Reiss, Z., 1993, 33, Academia Scientiarum et Artium Slovenica Classis IV: Historia Naturalis

General description

Agglutinated biserial test. Each chamber extends into fistulose chamberlets.

Representative pictures

Spirotextularia sp._13195

Specimens

Specimen 13195

Spirotextularia.sp_13195
Species Textulariida > Incertae sedis > Spirotextularia > Spirotextularia sp.
Isolate number 13195
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatcatattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacgattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtatctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctnntantcctttcatgattatgtgataggtggtgcatgccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgatcgcaacctcttgttgcctttatatacatttaaacgcgtgttatatatttttatatatttcacgtaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacacaccgcatgcgcgtgtccaattatttacgtactatttcaaatgcgtactttaattgtgtacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatatatgcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 3 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatncgnnacccntttcntgattatgtnanaggtggtgcatggtcgttcttaggtcggggagggaacngtctgcttaaatgccnttnactnaaggnttaaaaatatannngtgtggnantgntttttgncccctatcgttgnaatattacgtgnagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgngaccgcaacctcttgttgcctttacatttaaacgcgtattatgtatttttatacattttacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggktgsggcaataacaggtctgtgaagsccttagaagttccgggcygcacacgtggctcaatgattattgcagktggcatctcatttatttcacaccgcatggcggtgtcccattatttacgtactatttcaagtccgaccttwawtgtgtaccattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttacccngcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirotextularia sp. 13195 | genomic DNA | 13195 | marine sediment | taxon:998819 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttatgaatttattcataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattacgtgtagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacatttaaacgcgtgttatgtatttttatacatttcacgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgtgtccaattatttacgtactatttcagtgcgtactttaattgtgtacattgcgcgcggtaaagccctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcatctttaccccgcttgcgcttgtcgtaagttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccccccccgnatnnggtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtacctgtaaaaatttatttttactaatatcacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI