Alveolinella quoyi

Order “Miliolida” > Family “Alveolinidae” > Genus “Alveolinella

Original description Orbigny, A.D., , 1839, 2
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Hohenegger, J., Yordanova, E., Nakano, N., Tatzreiter, F., 1999, Mar. Micropal., 109-168
Further reference Leutenegger, S., 1984, J. For. Res., 14, 16-35

General description

Alveolinidae have fusiform tests that are elongated along the coiling axis. The chambers of A. quoi are divided into chamberlets and numerous apertures occur in several longitudinal rows. Living specimens are characterized by a brownish colour, due to their diatom endosymbionts.

Representative pictures

Alveolinella quoi Alveolinella quoi

Specimens

Specimen 300

Species Miliolida > Alveolinidae > Alveolinella > Alveolinella quoyi
Isolate number 300
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on October 1996
Habitat reef slope, hard bottom
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Alveolinella quoi | genomic DNA | 300 | taxon:128059 | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataatatatatatttcggtatatatatacaaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattgatatatatatatagttctgctctttgaattaagagattgtgaacatatattatattatgtatataatatttattaaatgaatgcaacgaacgtgactataaccttttattgctatattaacaagtattttnnntattatatatattattatataattagcttaaaattaaaggaaccgctgtcttatttaagtacttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcactttaataagtgtctaattaaacaaatnaattttatatataaataattctatttgtatataaaattcataataaacctatttcgaaagtgaatgggtaatcatttaaaaacgtgataaattaatttcatactacattatataaatataattatattaatatcattcatatgattattaattagttttatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaactatattattttcggataatataaaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Alveolinella quoi | genomic DNA | 300 | taxon:128059 | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcatttgtcttgacttagccatataatagatgtatttataataatacacaaataaatccaatacaatttggataactaagggaaagtttggctaatacggtacaataatatatttaatagaaattacattgtaataattctattaaataaaaaaaaataaatatacgcacatattgagaattatgattaacaatatgtaagtattatattacttttgtaatatataacagagcagacttaattaatatattttaattaagcatgtcatacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcactgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgataaaacatgctatatacataataatcaataatatatatatataattgattaacacacaaaaacaatataccttgtttaactgtaatactcttttgaggcagtgacaagctgtaaagattcattattatcttaagacttcatttggaattgtcgctataatatatttttatatattatagcttgataatataccaatgaagtaatataatgaatttgaatgcggtgattgtaataatttcaagtaacatgaataaacatttagttgtttatttgttatctgaattttcaagtagagggcaagtctggtgcaatcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnattgttgcggttaagaggctcgtagttggattgaaattacaaatgaatataatcattgatatatktaatataatgattcatatttcatttcaatactgtgaacaaaccagagtgtataaaacatgtaatataatttattattatgcattgaatgtttcatcatggaatattgcatataacataaattacaacttatacacagtacagtatataataagacatatatatagtatgtcgatggagatagttggagttaaaggtactgataagcgagcggtgaaatgctttgaccttattaagaccaacaaaagcgaaagcatttaactagattatactctttgtcgtcagtacgaacaatcaatataatatatatatttgattgcgtacaagtcaatttttacaatgaagagcgaaggttaggggaacaaagaggatcagataccctcgtcgtcctatttatacatcaaacgatgggatttcaattgaatatattatatacttattaattaagtatatattatagttttatttgttcctttaacaattaattttatatatggttgagttttatattcaaaactcctatattaaaattattattgntaattaaaatatttctatatatatcttatcttaattaattaatcaattattaatacttataaccattggggtttttgnatttaattggattatatgtacttmggcgctcaaatatataggtgagaagtaarcctttattataatnttattaggttattaatantaancttttaattgganttaattaatatttaaccttaantaaaaangnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataatatatatatttcggtatatatatacaaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattgatatatatatatagttctgctctttgaattaagagattgtgaacatatattatattatgtatataatatttattaaatgaatgcaacgaacgtgactataaccttttattgctatattaacaagtattttnnntattatatatattattatataattagcttaaaattaaaggaaccgctgtcttatttaagtacttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcactttaataagtgtctaattaaacaaatnaattttatatataaataattctatttgtatataaaattcataataaacctatttcgaaagtgaatgggtaatcatttaaaaacgtgataaattaatttcatactacattatataaatataattatattaatatcattcatatgattattaattagttttatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaactatattattttcggataatataaaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI