Borelis schlumbergeri

Order “Miliolida” > Family “Alveolinidae” > Genus “Borelis

Original description Reichel, M., 1937, Mém. Soc. Paléontol. Suisse, 95-147
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)

General description

The genus Borelis possesses spherical to fusiform tests, chambers are divided into chamberlets. Multiple apertures occur in a single row. Living specimens appear brownish in colour due to diatom endosymbionts

Representative pictures

Borelis schlumbergeri Borelis schlumbergeri

Specimens

Specimen 191

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 191
Collector Colomban de Vargas
Collected on May 1996
Location Atlantic Ocean, Bermuda

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataacatataatatatatttaatatatattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattataatatttttatatagttctgctccttttgtgagattgtgaacatatattttattatatatataaaatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaataaattaattactttggtattaatatataatacagcttaaaattaaaggaaccgctgtctattttaagtgcttaaacagtgtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattataatttttataatatatattatttataaatctatataaaaacctatttcgaaagtgaatgggtaatcatctaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Borelis schlumbergeri | genomic DNA | 191 | taxon:128061 | Bermuda | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcatttgtcttgacttagcataaaatasatgtttaattacattyatagcaaaatccattaaaatatatttaatatattttggataactaagggaaagtttggctaatacgtacaatacattatatattaatttaacattggtaattaatatatataatacatacgcatatattgaattcattgcaacatgattgacaatatataagtatttatattacttcggtaatatataacaccagcagacttaattaatatttgtthaattaagcatgtcatacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcactgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgataaaacatgctaatatataattaatataattaatataaattatattaatacatatatttaaacaatacaaccttgtttaactatctctcttttgaggcagtgacaagctgtaaagattcattattatcttaagacttcatttggaattgtcgctataatatatttttatatattatagcttgataatataccaatgaagtaatataatgaatttgaatgcggtgattgtaataatttcaagtaacattaataaatatttagttatttattatttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaaaatcaattggaaaatatatatattaacacaatatacttaatatatatattatttcaatactgtgaacaaaccagagtgtataaaacatgtaatataatttattattatgcattgaatgtttcatcatggaatattgcatacataatataataaataatatattacatataatttatatacaattgtgtcgatggagatagttggagttaaaggtactgataagcgagcggtgaaatgctttgaccttattaagaccaacaaaagcgaaagcatttaactagattattctctttgtcttatatatacatgcaatatataaacacgtattatatattggcaatagtatatattcatttttacaatgaagagcgaaggttaggggaacaaagaggatcagataccctcgtcgtcctatttatacatcaaacgatgggatttcaattgaatatttttatatacttattaattaagtatatataatatgtttatttgttcctttaacaattaattatttatatggttgagtttaatttgaactcctatatattaattaatgttaatttaaatatttctattatatttcatcttaattaattaattaatattaatatattatgcccttgtgtatttatattaattgattatatgtactttgcgctcaatttataggtgagatgtaagcattattatattgtattagtttttatataatctttattgtattattataataacttaatataatatatatcacaaatgtaatgygatgcacgttytaggtacaagcttactatagaaatatttaaaataataccctcctggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgataacatataatatatatttaatatatattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaatattatatattataatatttttatatagttctgctccttttgtgagattgtgaacatatattttattatatatataaaatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaataaattaattactttggtattaatatataatacagcttaaaattaaaggaaccgctgtctattttaagtgcttaaacagtgtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattataatttttataatatatattatttataaatctatataaaaacctatttcgaaagtgaatgggtaatcatctaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 365

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 365
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat Reef sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Borelis schlumbergeri | genomic DNA | 365 | marine sediment sample | taxon:128061 | 16 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttatcaggtccagacatattgaggattgacaggcgataacatataataatattttatatattattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaataatatatattataatatttttatatagttctgctcctatttttagtgagattgtgaacatatattttattatatatatattatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaaatatattaattactttggtattaatatataatatagcttaaaattaaaggaaccgctgtctattttaagtgcttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattatatattttcttataatatatattatttataaatctatataaaacctatttcgaaagtgaatgggtaatcatttaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI