Siphonaperta sp.

Order “Miliolida” > Family “Hauerinidae” > Genus “Siphonaperta

Original description of genus Vella, P., 1957, Pal. Bull. Wellington, New Zealand, 28, 1-64
Further reference Hottinger, L., Halicz, E., Reiss, Z., 1993, 33, Academia Scientiarum et Artium Slovenica Classis IV: Historia Naturalis
Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York

General description

Agglutinated test, chambers arranged in quinqueloculine manner. Aperture at the end of a short neck.

Representative pictures

Siphonaperta sp._13213

Specimens

Specimen 13213

Siphonaperta sp._13213
Species Miliolida > Hauerinidae > Siphonaperta > Siphonaperta sp.
Isolate number 13213
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 26 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggnnnatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgnttnctttggcgacttcggtcaaaagggaagnnttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagantcccgcctgtgcttgtggtacgccacgagtacggtttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccnntttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgaagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 28 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccgacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI