Peneroplis pertusus

Order “Miliolida” > Family “Peneroplidae” > Genus “Peneroplis

Original description Forskal, P., 1775, Copenhagen, 125
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Description Cimerman, F., Langer, M., , 1991, 30, Academia Scientiarum et Artium Slovenica Classis IV: Historia Naturalis, 1-119

General description

Discoidal test, central part of the test is inflated, one to two rows of apertures are aligned in a median groove. The test surface is ornamented with longitudinal stria. Living specimens have a distinct purple colour due to rhodophycean symbionts.

Representative pictures

Peneroplis pertusus

Specimens

Specimen 1325

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 1325
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Habitat Reef sediment
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

>Peneroplis pertusus | genomic DNA | 1325 | marine sediment sample | taxon:46137 | 1 | USA:Florida Keys, Conch Reef | Apr-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 6674

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 6674
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis pertusus | genomic DNA | 6674 | marine sediment sample | taxon:46137 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaaatatagttagttatatttggataactaagggaaagtttggctaatacgtttatataatacgtaaatataatatttatagcatattatgatatcattgcaacatgattgacataatataaatatataatacatttatttgtattaatattttgcagactttatagtaattataacttataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtaattaatatatataatatataccttgtatactgtattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcnctttgtataatttattatacattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgattttaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaataattatacatattatatacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcaatataattataaatattattgttagttagttatatcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgtaagcncttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatgtgatacatataatataatattcccttcaacttatattatacatgtatagttgagtacttaatttgtactcctatatatattataaattgaatatttattaattataatcataaatgattatatgtactttgcgctcatattatttaaaaggtgagatgtaagcattataggagagtaatatacttatatcatattatatgtgtataatgtattattataatccttaattaataaacgtaatgngatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI