Peneroplis planatus

Order “Miliolida” > Family “Peneroplidae” > Genus “Peneroplis

Original description Fichtel, L., Moll, J., P., C., 1798, Vienna, Camesina
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Description Cimerman, F., Langer, M., , 1991, 30, Academia Scientiarum et Artium Slovenica Classis IV: Historia Naturalis, 1-119

General description

Compressed test with involute and planispirally enrolled chambers in an early stage. Longitudinal stria as surface ornaments, apertures are arranged in a series of pores. As in all Peneroplidae, chambers have no internal subdivisions and rhodophyceans are housed as endosymbionts.

Representative pictures

Peneroplis planatus Peneroplis planatus

Specimens

Specimen 1359

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 1359
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 1359 | marine sediment sample | taxon:128053 | 7 | USA:Florida Keys | May-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggtcgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaaataatacacttggccttaactaggaatgccttgtactcttctttggtttaacattccaagaggaatacgtccctgccctttgtacacaccgcccctcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 362

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 362
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 362 | marine sediment sample | taxon:128053 | 1 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatatgtaatatataatttaatattgtgctgccttatatatataattatataggattttaagtgaacatattttattattacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaagggggggatagtgtattgttaaatattacacttggccttaaccaagaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 496

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 496
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis planatus | genomic DNA | 496 | taxon:128053 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaatagttataatccaaaatttggataactaagggaaagtttggctaatacgtttaatacgtaatacacatatatatattgcatattacgatatatcattattgcaacatgattgacgtaatataaatattataatacatttatttgtattaatatagagcagactttataatatttttataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgaataccttgtatacactatactcatatataatatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattggaatttgaatgcggtgattttaataatttcaagtacatggtataatatttattttaatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatatgtttacacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcayattaataaataattaattatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatgatatatattcccttcaatatacttaatacatttttatagttgagtatattattattatgtactcctatattaatatttgtgttttaatattgaatatttaattataatcataaatgattatatgtactttgcgctcataatatttaatcaggtgagatgtaagcattataggtgattaatatgcttatatatcatatgyatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattatatattcgttataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgcctttttataaaggattttaagtgaacatattttattagtacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaacctttgattgctataaataatatttatatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatattaatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattggtatactaatattataataatatttataatattattataaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggttcaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacattatacatatattaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 510

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 510
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 510 | marine sediment sample | taxon:128053 | 4 | Australia:Lizard Island | Sep-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagattattatatatttatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatgcattatatagtaatatataatttaatattgtgctgccttatatttatatataaggattttaagtgaacatattaatattgttttgctatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataattaatgttaattcattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatcaactacacttaataagtgttaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatggtatatctatattatgtatatagtattttactattacataaataccattaactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacgtactatcagtacattgaaactcatacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 6675

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 6675
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 6675 | marine sediment sample | taxon:128053 | 14 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctgttataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatactgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI