Spirolina acicularis

Order “Miliolida” > Family “Peneroplidae” > Genus “Spirolina

Original description Batsch, A., I., G., C.,, 1791, Jena
Description Bock, W., D., Lynts, G., W., Smith, S., Wright, R., Hay, W., W., Jones, J., I., 1971, Miami Geological Society Publications, Memoir 1

General description

Peneroplid coiling of early chambers. The later portion of the test becomes uncoiled and uniserial. Living specimens are red due to rhodophycean symbionts.

Representative pictures

Spirulina acicularis

Specimens

Specimen 756

Species Miliolida > Peneroplidae > Spirolina > Spirolina acicularis
Isolate number 756
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina acicularis | genomic DNA | 756 | marine sediment sample | taxon:577500 | 10 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaatcttaccaggtccggacatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatgtttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgccgtctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI