Archaias angulatus

Order “Miliolida” > Family “Soritidae” > Genus “Archaias

Original description Fichtel, L., Moll, J., P., C., 1798, Vienna, Camesina
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)

General description

Early chambers in Archaias are planispiral and involute while later ones become cyclical and evolute and are divided by interseptal pillars. Living specimens are green because of their endosymbionts.

Representative pictures

Archaias angulatus Archaias angulatus; living specimen

Specimens

Specimen 6668

Archaias angulatus 6668
Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 6668
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat Reef sediment
Location Brazil, Maracajau Reef

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias sp. 6668 MH-2008 | genomic DNA | 6668 | marine sediment sample | taxon:577497 | Brazil:Natal | 25-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatagaaaataataatagttatatttggataactaagggaaagtttggctaatacgttttttgtattaataatacatatgcatataataatattgcaacatgatagatattatataaataataaatagtatttatttagtatagagtggactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttatgttattattaaacttaatatattatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatgttttaattttatatgttattcgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatattatatataatatacaatactgtgaacaaaccagagtgtataaaacatgtaatatttttaattattagcaatgaatgttttatcatgggatattgctaatatatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctatnaagactaacaaaagcgaaggcacttaactagattattctctttntattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataaattattctctcaactaataattaaaaatgattgagtgtaattatttaatatactctcatttataattatacatgttgatattacacactatgattatatgtactttgggctcatataattatataggtgagatgtaagcattatagatgattaatatatttactacatattgtaaatattattataattctaaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggnagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 676

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 676
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth <1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 676 | taxon:46130 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 71

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 71
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias sp. 71 MH-2008 | genomic DNA | 71 | marine sediment sample | taxon:577506 | 1 | Puerto Rico | Apr-1995 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI

Specimen 72

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 72
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 72 | taxon:46130 | Puerto Rico | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattcatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacatatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 879

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 879
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth < 1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias angulatus | genomic DNA | 879 | taxon:46130 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataataatagttatatttggataactaagggaaagtttggctaatacgttttagatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataatattataattacattattgtaattatataagagcagactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataatataacttaatatataataatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattttatattgttttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttaattatattatttgaattttcaagtggagggcaagtctggtgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatcacagactgtattcaatactgtgaacaaaccagaatgtataaaatatgttaatattaatatcattagcaatgaatgttttatcatggaatattgcatatttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcagactatgggatttcaattgaatatagtttacttcaactattaaataatatatgattgagtataattataatactctcatatttaattaatattttgaatattatttcaaattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgatcaatatatatactttttagtatgtattattgtaattctaattaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI