Elphidium albiumbilicatum

Order “Rotaliida” > Family “Elphidiidae” > Genus “Elphidium

Original description Weiss Lawrence, 1954, Survey Prof. Paper
Further reference Pillet L, de Vargas C, Pawlowski J, 2011-07-01, Protist, 162, 3, 394-404

General description

Test planispiral, bilaterally symmetrical; sutural canal system opens into a single row of pores; septal bridges usually hollow and contain a retral process; aperture a series of large circular pores at base of aperture face.

Representative pictures

Specimens

Specimen 10013

E. albiumbilicatum from White Sea E. albiumbilicatum from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium albiumbilicatum
Isolate number 10013
Collector Sergei Korsun
Identifier Sergei Korsun
Collected on May 2008
Location White sea, Umba, Russia
Latitude, Longitude 66.6553, 34.4086

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcctgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcgacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaatgtatttatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcttgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcagacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaacgtatataatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI

Other sequences

SSU total

>Elphidium albiumbilicatum | genomic DNA | 10013.1 | taxon:933847 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatggagtggtaatcaatatattacccgacagtttaaataagtgattcgcaaccactcactatacacgcacgctgwatatacdacgcacgactcggtacaaactcgactatatgaagcctcttttattctatctcrcagggagtatagttttttacgccatacgtagagtataaacaacgcatagcatacacttatgcaactgcwgatagctgcttaatacagttacacttgtcttgacttggcaattaatacacacacaacgcggtgtatatatgatatgacacacactgcgcgttatacccacccacacacacagctaaaggtaaattatcttaaagcaagtgttacccggtaccaatgatcaacacgggaaggcaggccttaaaggagtatgccgatctgcggggaaagtaacctatgtgactagactgtatttactgagattttgaagttattaagccgtataaacaatccatgcgacatataacacgcagggtgtataatgtcccaagcgcgtaacatatcctgcgttgggtgtttatgaactatataccgaagggatatagataggtgctaacgtctgcaacacgtttggaacggcgcgtagtaaaacaagagaataaccttaatcgcatagcatttttacatatacgacgtggtgacgcgcgtatttgttattagtaacggcaggtggctatactaaatggcctttgactactcatgcagatcgcggggataatcatactaaaagccaatatancggcacccgtagagtgagtatcattgtgtacaatacaccaccgcgtgtattaattaatatactatagatgcgatntctgatgtaatccacccatacacacacacacacgacggataactcagggaaagtttggctaatacgtacgacacacacacacacacgatactaatactcggcactcaatgggatgtttatatacctcctttgcttcatgaaagacattgagtacgcttgcaccttccattcattaacgtgaatagcaaacacgctgagcagacttcaatatatttatatattgaagcgtgtcatacaagcatctatagcatcaagttacgggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcacagtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtaccaaacgcaggtatataatatggaataatttactgtaccgtcgtcgtcgtaaatacacgcattatatagtaccccttgacgcatacctttcaacgcagcgcgtatagtagaaattcccttctattatattcaatgtaatgaggcagtgacaagctgtaacggttgagtataaaaaatgacgagtgtctagcattgtcgccttcgggcttggcattattgctgacgcttcgtatgctcaattggactgcggtgagttcaatatactcagaaccattcatacacagccgccgctgtgtatgaattatctgaataacttcaagtagagggcaagtctggtgccagcagccgcggtaataccagctctactggcctatacaatcattgttgcggttaagaggctcgtagttggattggaaatatactgcacacacacacacgcagatatatatactacctacgggtggttcgactatcattaacacgcacgcacgcgcagatacaacactgtgaacaaatcagagtgtatcatacatgtcttttaattaaaattatgcattgaatgtctcatcatgggatgttgcaatatatactacgtgtcgcacacacgggatacaatgataagtcgatggggatagttggagttagcagtactgttgggcgagcggtgaaatacgttgaccctggcaagactaccagaagcgaaagcggctaactaggctattctctttgtgaatgtaccatacaccacgcacgcgcacgtatgacacacacaatatacacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaactatgggctctcattcgctacataatgcagagacaaaaacgacactccctcataacaaccatacaataaaaatatatacattacgccttgattgagcctaccctgctctcatatagtaatcaatattttatatacggtctcgatggacgtttttaaatatatatatttttatatatttatttgcgtgtaagctatccattggatacgcgtacactttgattttaggagctttgagctcatattatcaatggttagatgcaagtatcaatacatgtgtgtgagtcatattaatctatgacacacacacatacatacaaaacatgatacgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcctgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcgacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaatgtatttatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI

SSU total

>Elphidium albiumbilicatum | genomic DNA | 10013.2 | taxon:933847 | SSU | SSU | small subunit ribosomal RNA cactcactatacacgcacgctgtatatacgacgcacgactcggtacaaactcgactatatgaagcctcttttattctatctcacagggagtatagttttttacgccatacgtagagtataaacaacgcatagcatacacttatgcaactgcagatagctgcttaatacagttacacttgtcttgacttggcaattaatacacacacaacgcggtgtatatatgatatgacacacactgcgcgttatacccacccacacacacacagctaaaggtaaattatcttaaagcaagtgttacccggtaccaatgatcaacacgggaaggcaggccttaaaggagtatgccgatctgcggggaaagtaacctatgtgactagactgtatttactgagattttgaagttattaagccgtataaacaatccatgcgacatataacacgcagggtgtataatgtcccaagcgcgtaacatatcctgcgttgggtgtttatgaactatataccgaagggatatagataggtgctaacgtctgcaacacgtttggagcgncgcgtagtaaaacaagagaataaccttaatcgcatagcatttttacatatacgacgtggtgacgcgcgtatttgttattagtaacggcaggtggctatactaaatggcctttgactactcatgcagatcgcggggataatcatactaaaagccaatatancggcacccgtagagtgagtatcattgtgtacaatacaccaccgcgtgtattaattaatatactatagatgcgatttctgatgtaatccacccatacacacacacacacgacggataactcagggaaagtttggctaatacgtacgacacacacacacacacgatactaatactcggcactcaatgggatgtttatatacctcctttgcttcatgaaagacattgagtacgcttgcaccttccattcattaacgtgaatagcaaacacgctgagcagacttcaatatatttatatattgaagcgtgtcatacaagcatctatagcatcaagttacgggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcacagtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgttagtaccaaacgcaggtatataatatggaataatttactgtaccgtcgtcgtcgtaaatacacgcattatatagtaccccttgacgcatacctttcaacgcagcgcgtatagtagaaattcccttctrttatattcaatgtaatgaggcagtgacaagctgtaacggttgagtataaaaaatgacgagtgtctagcattgtcgccttcgggcttggcattattgctgacgcttcgtatgctcaattggactgcggtgagttcaatatactcagaaccattcatacacagccgccgctgtgtatgaattatctgaataacttcaagtagagggcaagtctggtgccagcagccgcggtaataccagctctactggcctatacaatcattgttgcggttaagaggctcgtagttggattggaaatatactgcacacacacacacgcagatatatatactacctacgggtggttcgactatcattaacacgcacgcacgcgcagatacaacactgtgaacaaatcagagtgtatcatacatgtcttttaattaaaattatgcattgaatgtctcatcatgggatgttgcaatatatactacgtgtcgcacacacgggatacaatgataagtcgatggggatagttggagttagcagtactgttgggcgagcggtgaaatacgttgaccctggcaagactaccagaagcgaaagcggctaactaggctattctctttgtgaatgtaccatacaccacgcacgcgcacgtatgacacacacaatatacacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaactatgggctctcattcgctacataatgcagagacaaaaacgacactccctcataacaaccatacaataaaaatatatacattacgccttgattgagcctaccctgctctcatatagtaatcaatattttatatacggtctcgatggacgtttttaaatatatatatttttatatatttatttgcgtgtaagctatccattggatacgcgtacactttgattttaggagctttgagctcatattatcaatggttagatgcaagtatcaatacatgtgtgtgagtcatattaatctatgacacacacacatacatacaaaacatgatacgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcaggaaatcttaccgggtccggacacactgaggattgacagataacgtgctgttatacggtgcaaaatatgatagctctttcataattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttggtatatataatgcatgttaattgcatttttaccatgcaacgaacgtgaccgcaacctcttgttgcactatagcttctcatggtgcaaaactagagggaccgctgtatttatttcttttagccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgtcccgggctgcacacgtgctacaatgattattgcactgcgtatcttctaacgcggcgatttaattaatttaaaatcaccgcagacacccgtgtcgataggctatacgggtaaccctttagaagtaatgatttccaacgtatataatatcaactcatggtggggacagaccattgataattgttggtctcggtcacaactaggaatgccttgtacgagttggttcattaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgga

See sequence on NCBI