Elphidium williamsoni

Order “Rotaliida” > Family “Elphidiidae” > Genus “Elphidium

Original description Haynes, J., R., 1973, Bull. Br. Mus. (Nat. Hist.) Zool. Suppl. 4, 1-245
Description Hayward, B., W., Hollis, C., Grenfell., H., 1997, New Zealand Geol. Surv. Paleontol. Bull., 72, Institute of Geological and Nuclear Sciences monograph 16.

General description

Test with evenly rounded outline, becoming lobulate in later part; periphery broadly rounded to sub-acute; septal bridges long, evenly spaced, numerous.

Representative pictures

Specimens

Specimen 10017

E. williamsoni from White Sea E. williamsoni from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium williamsoni
Isolate number 10017
Collector Sergei Korsun
Identifier Sergei Korsun
Collected on January 2004
Location White sea, Umba, Russia
Latitude, Longitude 66.6553, 34.4086

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttctcatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgaccccccgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacgccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaatttatttctatatataaagatgctggttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatatactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatatctttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI

Other sequences

SSU total

>Elphidium williamsoni | genomic DNA | 10017.1 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA gcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtgtgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgataggctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttatttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatatatatacacacatgttatatattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaaacgtaaaaagatacattcttatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttctcatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgaccccccgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacgccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI

SSU total

>Elphidium williamsoni | genomic DNA | 10017.2 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtgtgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgataagctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttatttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatatatatacacacatgttatatattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaacgtaaaaagatacattcttatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaatttatttctatatataaagatgctggttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatatactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatatctttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggac

See sequence on NCBI

Specimen C6

E. williamsoni from White Sea E. williamsoni from White Sea
Species Rotaliida > Elphidiidae > Elphidium > Elphidium williamsoni
Isolate number C6
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequence

SSU total

>Elphidium williamsoni | genomic DNA | C6.1 | taxon:139273 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttttataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttatatatatttcacagtactctacggataacttagggaaagtttggctaatacgtacgaacaattttattatcgcatacagttacatcatgaatgagactgtatacgtgcgcgtatgattttatatcataccgcacacggcagatattgtattttattatacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatatataacacttattcacacatacgtctctctctattgaggcagtgacaagctgtaacggttgagtattaatctattttgacgtgtatctggcatgcgttttacgtttacgcgtaaattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttttacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaacaatatttatattattacaacactgtgatcaaatcagcatgtatcacgtatgtatttactaaaattacgcattgtatgtttattcatggaatgttgcatatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattcttttacatacatatatacacaatgttattctctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaaaacgtaaaaagatacatttcatgtatcattatacaatatacttttgattttctaagctttgcgctcaatttattatacggtgagatgtaagtaatggctgtatatttttatacacgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagattttcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatatagaaattttatatttcttatatataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatttttattatgtatacgtatgacccacgtttacgcgtgcgagtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatatacgcacgcgtatatttattcattaaagggaccgctgtttctttttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctactatactgcacattatgtgtattaaaacctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaactatgtaccgtatattacatcccataatattttttttattatgcgtgtgtgttttattaccgtgtacgcgtaattgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctgttggactgtatcctttaatgaatacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI