Elphidium margaritaceum

Order “Rotaliida” > Family “Elphidiidae” > Genus “Elphidium

Original description Cushman, J. A., 1930, United States National Museum bulletin 104, 79pp.
Description Buzas, M., A., Culver, S., J., Isham, L., B., 1985, Journal of Paleontology, 59, 1075-1090

General description

Test planispiral, bilaterally symmetrical; sutural canal system opens into a single row of pores; septal bridges usually hollow and contain a retral process; aperture a series of large circular pores at base of aperture face.

Representative pictures

Specimens

Specimen A108

E. margaritaceum A108 E. margaritaceum A108 E. margaritaceum A108
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A108
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Roscoff, France
Latitude, Longitude 48.7273, -3.99092

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium margaritaceum | genomic DNA | A108.1 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttaatatattaaccctatcagtttaaacatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattatcatacggcgctctacggataactcagggaaagtttggctaatacgtacgaacaacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttatattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgagccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcagacgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagcgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgacactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatatttgatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaatatacacaatactgtgatcaaatcagcacgtatcacgtatgtaatattatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttccaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaggtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium margaritaceum | genomic DNA | A108.2 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA aaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattttcgatcatacggcgctcaacggataactcagggaaagtttggctaatacgtacgaacacacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatattaatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggmctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccactatacacaatactgtgatcaaatcagcacgtatcacgtatgtattttttaatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen A13

E. margaritaceum A13 E. margaritaceum A13 E. margaritaceum A13
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A13
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta See sequence on NCBI

See sequence on NCBI

Other sequence

SSU total

>Elphidium margaritaceum | genomic DNA | A13 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatyttwaaaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttactactactacgctcttacggataactcagggaaagtttggctaatacgtacgaacaaattctatattcgcatacagttacgcatgaatgagattgtatacgtgcgcatgtttattcatcgcacacggcagatattgtaattttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtataattacttcacctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatgtttcattacatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaattgttacaatactgtgatcaaatcagcacgtatcacgtatgcatttttaatatgcattgtatgtttattcatggaatgttgtatttttatatgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacattacactctgtattcacactctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaatatatttatacgttttacgtattttatattattttactgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtattttattacgtgtgctaaattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI