Elphidium excavatum

Order “Rotaliida” > Family “Elphidiidae” > Genus “Elphidium

Original description Terquem, O., 1875
Description Hayward, B., W., Hollis, C., Grenfell., H., 1997, New Zealand Geol. Surv. Paleontol. Bull., 72, Institute of Geological and Nuclear Sciences monograph 16.

General description

Test involute, envenly rounded to lobulate; periphery broadly rounded to sub-acute, no keel; papillae ornament sutural pits umbilicus and base of aperture face; umbilicus depressed or filled with one or more bosses.

Representative pictures

Specimens

Specimen 6009

E. excavatum A220 E. excavatum A220 E. excavatum A220
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number 6009
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on May 2006
Location Wadden sea, Mook Baai, Netherland
Latitude, Longitude 53.0006, 4.78765

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttccgagagtttttgcttcggcaatgctctcttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttttactaaaggcgtcatatctgttttgtgcgtgtttgacccctcttcggagcgcgtgtcttcacgcacaattactttggcgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgtttgtttttgcaggcagtatatggaggcttttttactcaacaactagagggaccgctgtttctttctttaaaccagaggaaggatacggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgttttactgcgtggcattgcaatccatatttcttcggaagtgtgtttttgttttccgcctcaacctgcttcgaaagcatgcgggtaaccaattagaagtagtgatttccttttttataagcacactaatatggggcatcatcacccggcatgccttgttgtatgttttgtgtgtggtgtttgcttttccatgtgcttttgtcaattcatagtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttatggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagtcggcaggaccgtttaggaaatgttcgcgaataatgtgatct

See sequence on NCBI

Other sequence

SSU total

>Elphidium excavatum | genomic DNA | 6009 | J. Pawlowski 6009 (UniGE) | taxon:212501 | originally identified as Elphidium williamsoni | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgttggtattcagtatacacaccaaacaagtgatacatatcacttatgcaactgcagacagctgcttaatacagtcgcacttgtcttgacttggcacaacccatttacactgtgaccgtttgtcttcgggcagcacacagatgtaaaatgatacacgcacccaaaatgctaaaaaacaaaattaacggataactcagggaaagtttggctaatacgtacgaactatatgatgaattctacacacacacacaccccattcattcatattcacattcagtggttggttttatccatgcgcaacatgagagacactgaacacgcagtatgtgtacgacttcggtctacgcatacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacaatgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccagtgatagtacaatttatttttttactactgaatttaccacacgcaaatttaatactgtacgaaaaaaaataatttattgagacagtgacaagctgtaacggttgagtatataaattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggccattggtgtttgcgtaatgctttcatcatttgggtgtatctgaattttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaataacttttacgacgttgtaagaaaatctttagaattttctacacacacacacacccactttttcaacactgtgaacaaatcagagtgtatcaaacatgtctttttacacgcactgagtgtccgatcatggaatgttgcttatgtaaatattttgacatgtacactcactctaaaatttttatttacacgtcgatggagatagttggagtcaacagtattactgggcgagcggtgaaatgcattgaccctagtacgactaccaaaagcgaaagcagttggctaggctatactctttgtggatgcatgtttgcgtgactatatgatttgctaagattttacacgcacactgacaaaaaaagcaaatttcattgatcgcacatgcaatacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacacttttccgtgtgtagttgttttattatattcccaacctgcaacatttttagctgacttgagcttacgctcgtcgctttaaattcattgctaactcaggagttaatattttccgcacatactttctatacggtagttattaatgcgatgtattcatgtttttaatgtgtttcttcgttgactactctgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtattatggtacgtcgttgccttcgggtgacactactcattttttacattcacaaattttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttccgagagtttttgcttcggcaatgctctcttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttttactaaaggcgtcatatctgttttgtgcgtgtttgacccctcttcggagcgcgtgtcttcacgcacaattactttggcgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgtttgtttttgcaggcagtatatggaggcttttttactcaacaactagagggaccgctgtttctttctttaaaccagaggaaggatacggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgttttactgcgtggcattgcaatccatatttcttcggaagtgtgtttttgttttccgcctcaacctgcttcgaaagcatgcgggtaaccaattagaagtagtgatttccttttttataagcacactaatatggggcatcatcacccggcatgccttgttgtatgttttgtgtgtggtgtttgcttttccatgtgcttttgtcaattcatagtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttatggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagtcggcaggaccgtttaggaaatgttcgcgaataatgtgatct

See sequence on NCBI

Specimen C62

E. excavatum A227 E. excavatum A227 E. excavatum A227
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number C62
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

SSU total

>Elphidium excavatum | genomic DNA | C62.1 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA agccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaatatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacactgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatacgcgttgtaggcaatttgttgatgtagtcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtatatcttcaaataccgtctataaacgtgtgtgtgtgtgtatgtattagatatttgtgcacgcgtgttgtatatacgtccctgtacttatttatgtgtgtgtggtgctatgtacgtgtcgtcgtatgctctctaaaaaaacacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcttgcacataaaaccaactcacccaaacggttttgtgttcacgcacacgcgcacatttctcacactttaaaaacgaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactntgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.2 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcgtacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacattcctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgccgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcgtttttactttcacaatccttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.3 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacctttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcatacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaaganccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacatttctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagtggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctataattgttgtgtaacacacacacccctttgagttgctttgtgtagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgctgggtaattttattgccacccacaatgcgcttcggtgctgcgtgtgtcctttatttttaccacgtgcgcgaacgtgcattctcattcatctaaaacgacgtgtgcatttatatagtcatatcttttgtgtttataatacagtacagtactcatcactcacattgcctttgtcgtggaagtgttgttgtgattttgttatgcgctgtgaacatcttttgcaacgcactatactcacgccaatcgcaagagcggtgtgtgttggstttattttatacacrcagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacracaakacactgttgcataggacacwttacaacgaagaacgaaggttgggggatcaaagaggatcagatacsctcgtcgtcccatttttacatcagacgatgggctctcaattgcacactttaccgtgtgtagntgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagntttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI