Heterostegina depressa

Order “Rotaliida” > Family “Nummulitidae” > Genus “Heterostegina

Original description Orbigny, A. D’, 1826, Annales du Museum d’Histoire Naturelles, Paris, 7, 1-275
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28
Further reference Holzmann M., Hohenegger J., Pawlowski J., 2003, J. For. Res., 33, 277-284 (127 KB)
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hottinger, L., 1977, Mémoires du Muséum National d`Histoire Naturelle, Paris., 40, Série C, 1-159

General description

Central part of the test is thickened, early chambers are undivided, later ones are divided by secondary septa. Diatom symbionts lead to a brownish colour in living specimens.

Representative pictures

Heterostegina depressa Heterostegina depressa Heterostegina depressa

Specimens

Specimen 27

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 27
Collector Johann Hohenegger
Collected on March 2004
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 27 | sediment sample | taxon:196924 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcacactttgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatcttttttataagattacgctttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgccgagtctatttattcaccttaagtgtgcttaaatatgtatctctgcgcgcggtaaagcctgtttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 3
Collector Johann Hohenegger
Collected on March 2004
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtatttgtttgcttagcacatacaattaggaccagaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacgtttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Heterostegina depressa | genomic DNA | 3 | sediment sample | taxon:196924 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattatacgagattgcttacggtagcaacgatttcagcgtgaatcacaccctacagtgaatcactgcaatgaatttcattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattatatgatattcgcgtatcatatatatatactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatcacacacatacacatacacatacaccaatgtatatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcaccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcctcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacacacatacactgtgtgcagcatatataacacattatatttattctgtcacccgacagaacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacactacatgaatgaattctattcgttctgcgtttgatagttttacgtgtcacgtattttatacgtttcgcgtatcgacgctacctaacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttattatactagcacactcgctctgctgtatcgcaacacacacatacacacccacactgcagcaactgagtgatcagtatataccatttacgtcatggtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatacgctgcgcataatattcacacacatacacacccgatgcagcagtggtaagcttactatacgctatgtaaaaaattcataacggttataaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgattaatcattatatgcacatgcagtcacacacatacacgcacacttctgcagtagtgacatataatatatattacattaccacacagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaattatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgtgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtacatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtatttgtttgcttagcacatacaattaggaccagaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacgtttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 308

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 308
Collector Rudolf Röttger
Identifier Rudolf Röttger
Collected on October 1996
Habitat soft sediment
Location Hawaii

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacctcagtgtgtgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatggttgtatctttatgattacgctttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatttgcagtgagcatctcattcttacacaccgcatgccgcgagtctatttattcacctttagtgtgctttaaaatatgtatctcttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequences

LSU partial

>Heterostegina depressa | genomic DNA | 308 | taxon:196924 | 6 | Australia:West Australia | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactacccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcgcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacatacacacccctgctgctgcaacgtgttaatacacatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacgctcgtaatacacacacacgcacgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

SSU total

>Heterostegina depressa | genomic DNA | 308 | sediment sample | taxon:196924 | single cell | Australia:Western Australia, Agamont | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattatacgaggttgcttacggtagtaacgatttcagcgtgaatcacaccctacagtgaatcactgcaatgaatttcattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattatgatattcgcgtatcatatatatatactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatcacacacatacacatacaccaatgtatatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcctcacatctacgctgagcagactttggcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacactgtgtgcagcatatataacacattatatttattctgtcacccgacagaacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacactatatgaatgaattctattcgttctgcgtttgatagttttacgtgttacgtattttatacgtttcgcgtatcgacgctacctaacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttattatactagcacactcgctctgctgtatcgtaacacacacacacacccacactgcagtaactgagtgatcagtatataccatttacgtcatggtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgtaagaattattacgtacatacgctgcgcataatattcacacacatacacacccgctgcagcagtggtaagcttattatacgctatgtaaaaaattcataacggttataaatgtcgatggggatagttggaagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagattccaaaagcgaagcagttggctaggttatactcttgggcttgcgccagggaattatcattataggcccatgcagtccacacacatacacacacttctgcagtagtggccatatatatttccattaccacacagcgcattacactttacaatgaagaacgaaggtttggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaattatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgtgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctctgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacctcagtgtgtgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatggttgtatctttatgattacgctttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatttgcagtgagcatctcattcttacacaccgcatgccgcgagtctatttattcacctttagtgtgctttaaaatatgtatctcttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 377

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 377
Collector John J. Lee
Collected on February 1997
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 1 | Israel:Elat, Red Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacttagtgttgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagaggggccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtaatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Heterostegina depressa | genomic DNA | 377 | taxon:196924 | 21 | Israel:Elat, Red Sea | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaacctaaccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcggcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacacacatacacacccatgctgctgcaacgtgtcaatacatatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacactcgtaatacacacacacgcatgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

Specimen 39

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 39
Collector Pamela Hallock
Collected on March 2004
Habitat soft sediment
Depth 18m
Location USA, Florida Keys, off Key Largo
Latitude, Longitude 25.06, -80.43

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 39 | sediment sample | taxon:196924 | single cell | USA:Key Largo, Florida | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatgatcaccatttttatgtgtgtatcatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattggcaatgagcatctcatttttacacacgcatgcgccgagtctatttattcaccttaagtgtgctttaaaatatgtatctctgcgcgcggtaaagcctgttccgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatcttttacccgggttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgtaaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaggggctgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 642

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 642
Collector Maria Holzmann
Collected on September 1997
Habitat Reef rubble
Location Maldives, Helengeli

Barcode sequence

SSU partial

>Heterostegina depressa | genomic DNA | 642 | taxon:196924 | 1 | Maldives:Helengeli | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacctagtgtgtatcaatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagcacatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatagttgtatctttatgattacactttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcacctttagtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggaccgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Heterostegina depressa | genomic DNA | 642 | taxon:196924 | 15 | Maldives:Helengeli | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcgcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacatacacacccctgctgctgcaacgtgtcaatacacatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacgctcgtaatacacacacacgcacgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI