Operculina elegans

Order “Rotaliida” > Family “Nummulitidae” > Genus “Operculina

Original description Cushman, A., J., 1921, U. S. Nat. Mus. Bull. Washington, D. C., USA, 4
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Yordanova, E., Hohenegger, J., 2004, Micropaleontology, 50, 149-177

General description

Flat semiinvolute to evolute tests and nearly smooth test surfaces, scarcely covered with knobs. O. elegans resemblesin these aspects O.complanata. What distinguishes the two species are septal flaps that are smooth in O. elegans and folded in O. complanata. Brownish colour in living specimens caused by diatom symbionts.

Representative pictures

Operculina elegans

Specimens

Specimen 54

Species Rotaliida > Nummulitidae > Operculina > Operculina elegans
Isolate number 54
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Depth 40m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatttacactcttacagtgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaacagagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacaccgttgcagtaaatatttttaataatcttgcttcgtgcaaaaagggccttttaaactagagggaccgctggttactttcttaaaccagaagaaggttgccggcaataacagggtctgtgatggccttagatggtccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctaattattcaccattttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatatagcacacatatatcggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina elegans | genomic DNA | 54 | sediment sample | taxon:311568 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacactcatacacgcattatacgaggttgattacgggagtaacaatttcagcgtgaatcacatcatatagtgaatcactgaaatacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgattacgcatacactgtatcgtatcatatattatacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacacacatcacacatacacactcaatgtatatgtaagacactactcagcactcaatggtaaactttggcttcgtcgcgtcccaggtttaaaggtttaactgcacatgagagacattgagcacgcacgtgtcgaaccttcgggtgcttcacatttcgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcccgtacaatgagagaccgttcttagttctaaggaacgcagcaggcgcgtaaattgccccaatgctagtaccctacaatcacatacgattgatattattacgcgctaacaatttactaacagcatatataacacaattatatttattctgtcacccgacagaacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgtttgtaatatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaattatatgaatgaattctattcattctgcgtttgatagtttctacgcgtcactatatattatatattgtttcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttctgataacatgcacactcgctcctgtatcgttacacacatacacactctctgcagcaactgagtgatacaatatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcaatgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatatgctgcgctttaacacacatacaccactcacagcagctagctggtaagcttattgttatacgctatggaataaaattcaataacgggttaataaaatggtcgatggggataagttgggagtctacaagtactgctgggcgagaggtggaaattcattgaccctagcaaggacttccaaagcgaaagccagattggcttagggctatactccttggtgcttgcgccacgtggattatacgtaataagtctcgctgtccctaacaccacatacacactttgcggcagagatattattattatacacgtatccacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcgcttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtcttcgggcatttcatctgtcgtgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattattctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatttacactcttacagtgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaacagagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacaccgttgcagtaaatatttttaataatcttgcttcgtgcaaaaagggccttttaaactagagggaccgctggttactttcttaaaccagaagaaggttgccggcaataacagggtctgtgatggccttagatggtccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctaattattcaccattttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatatagcacacatatatcggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI