Ammonia sp. T8

Order “Rotaliida” > Family “Rotaliidae” > Genus “Ammonia

Revision Hayward, B., W., Holzmann, M., Grenfell, H., R., Pawlowski, J., 2004, Mar. Micropal., 50, 237-271 (1.58 MB)

General description

See the paper of Hayward et al., 2004 for a morphological characterization.

Representative pictures

Ammonia sp. T8, spiral view Ammonia sp. T8, umbilical view

Specimens

Specimen 1404

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1404
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequences

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 7 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggggtgtgtcgcacatacgttatacgcatagnnnntaggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgattcttctttaaaccagaggaaggatacsgcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgccttggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatatcatcatagtagaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 8 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgnnggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcacgattatgtgataggtggtgcatggccgttcttagttcgcggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggcgtgtgtcgcacatacgttatacgcataggtctcagatagcmaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 1405

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1405
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | marine sediment | taxon:155775 | 11 | true | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcntgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctcgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtaaaaccatatggtttgtgaccccctcgttaagaggcgtgtgtcgcacatatgtgttatacgcataggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagcatatagctgcgtcttaccaacgcgcaatatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcgcacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaccttcgcttgcgagggttagtggaaatatgtatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | taxon:155775 | 9 | single cell | true | Israel:Taba | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactatgtgcataatttagcccgtcgatactatcctagcatattaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaatatttatatacgtataacctacgcacacacacacatacctaaccgccaatatgtttctacgtactaggcaccttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcgcccatagtacgcgtataacatacacacacacatacacccaatggcgcgccggcagtgcagtgcacgtaaccatactgtatatatataacctgagtcgagttattt

See sequence on NCBI