Uvigerina elongatastriata

Representative pictures

Uvigerina elongatastriata_U273

Specimens

Specimen U273

Uvigerina elongatastriata_U273
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina elongatastriata
Isolate number U273
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 151m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.385, -9.1699

Barcode sequences

SSU partial

>Uvigerina elongatastriata | genomic DNA | U273-5 | taxon:212520 | small subunit ribosomal RNA aacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacacacacacacacacgcgcgctctcacgtgctgttgtgtgtgctgtagtgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggttcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaatttacgtatgtcagttatttttttacactttgacccctctgcttcacgtttcattacgctgcagtgcgtgtgtctttgttcttataaattaactcatacaatttaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttctttacgtgggtattaactacactcacacacatatacacactgcgtgtaaatgtgcgcgaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttatacaccgcatgcgcgagtccatttatttagcatcgtgtatttacgtacgcgtgtttttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttcctatttttttatattntgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgtgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtnttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgctgtaaatatattttttttttacgaatatattctta

See sequence on NCBI

SSU partial

>Uvigerina elongatastriata | genomic DNA | U273-4b | taxon:212520 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacacacacacacacacgcgctctcacgtgctgttgtgtgtgctgtagtgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaatttacgtatgtcagttatttttttacactttgacccctctgcttacgtttcattacgctgcagtgcgtgtgtctttgttctataaattaactcatacaatttaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttctttatgtgggtattaactacactcacacacatatacacacatgcgtgtaaatgtgcgcgaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttatacaccgcatgcgcgagtccatttatttagcatcgtgtatttacgtacgcgtgttttttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttcctatttttttatattctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctyttaccgatggacttctntgtgagtttgagggactgggaacgctgtaaatatattttttttttacgaatatattcttatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI