Haynesina orbiculare

Order “Rotaliida” > Family “Incertae sedis” > Genus “Haynesina

Original description Brady, H. B., 1881, Ann. Mag. Nat. Hist., London, 8, 415
Description Buzas, M., A., Culver, S., J., Isham, L., B., 1985, Journal of Paleontology, 59, 1075-1090
Further reference Pillet L, de Vargas C, Pawlowski J, 2011-07-01, Protist, 162, 3, 394-404

General description

Like H. germanica, this species lacks sutural bridges. Test periphery is rounded. The considerable development of granular material on the first chamber of the final whorl is typical of this species.

Representative pictures

Specimens

Specimen C131

H. orbiculare C130 H. orbiculare C130
Species Rotaliida > Incertae sedis > Haynesina > Haynesina orbiculare
Isolate number C131
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Haynesina orbiculare | genomic DNA | C131.1 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttaaggaaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatgcgtgtgggtgtgggcacaggcacactcacacgcctttctctgttatctatacacattcagataactgcatggataactcagggaaagtttggctaatacgtacgggtacgatgcttacatgacacatatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgaacaactaagttctgtgcagtaaggcggggtagacctcgtgagctagtaaaccgcggtcagtcaccatcatagcatcacgccgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgngcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagggctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatatagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggacatagcatgtattatatatacgcacacgctctcacactattactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgcgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaagtattgcgtgcatatttacattacgcacattaggtttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttgaacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgattttgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaacattatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacatattctaagtgcagacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaaataatatatgtcgatggkgatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgatttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattvscctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU total

>Haynesina orbiculare | genomic DNA | C131.2 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttgaagcaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatatgcgtgtgggtgtgagcacaggcacaccacacacgctcatttctctgttatctatacacacgtcgttcgcgataactgcatggataactcagggaaaatttggctaatacgtacgggtacgatgcatatatgacacattatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgctgtgcagtaagccggggtaccaaagcggatcacatgctgtaagtcacagagctgattacatagtaacacgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgggcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagagctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatttagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggatatagcatgtattatatacacgcacacgctctcacactatactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgtgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaggtattgcgtgcatatttacattacgcacatagattttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttggacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgatattgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggctaagaggctcgtagttggattgaactaacatttatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacacgttctaattgccgacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaattaatatatgtcgatggggatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgagttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacatnscctccgggggtagtatgcacgcaagtgtgaaactkgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI