Pullenia subcarinata

Order “Rotaliida” > Family “Incertae sedis” > Genus “Pullenia

Original description Orbigny, A. D`., 1839, Pitoit-Levrault, Paris
Description Mead, G., A., 1985, Micropaleontology, 31, 221-248

General description

Compressed forms that exhibit 4.5 to 5.5 chambers per whorl and a sub-rounded to sub-angular periphery.

Representative pictures

Pullenia subcarinata

Specimens

Specimen 1087

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1087
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgccacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1087 | taxon:325275 | 1087.4c | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggagacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaagga

See sequence on NCBI

Specimen 1148

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1148
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.56 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgctcgcgcattcagtataaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacgggagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtattcacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgtt

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.2b | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctggttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaagccacccggaatacgtccctgccctttgtacacaccgcccgtcgct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.57 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcnnnnnnnnggctcgacgttggattgaactgcaatatgaatgaattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaatttttcctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacacacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatggcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgccgtaaatattttctcacacacacacacacacacacgtacatgtttacatagcccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactcttttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcgacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagctgcttcgaaagtaagtgggtaatcaattagaagtaatgaatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | 1148.1c | small subunit ribosomal RNA | s14-sB region cactgaggattgacaggcaatattagtacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttacagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcgattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacg

See sequence on NCBI

Specimen 1850

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1850
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.4b | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaagaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgaggga

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.26 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.7 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattcggccgcactagtggatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcgagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaattttttctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacgcacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcatcnctgtgaacaaatcaagtgtatcaaacatgtcrtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgacgaaaatattttctcacacacacacacacacacacgtacatgtttacatagccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcactcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattcttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI