Cibicidoides dispars

Order “Rotaliida” > Family “Incertae sedis” > Genus “Cibicidoides

Original description Orbigny, A. D`., 1839, Pitoit-Levrault, Paris
Further reference Schweizer, M., Fontaine, D., Pawlowski, J., 2011, Revue de Micropaléontologie, 54, 175-182 (617 KB)

General description

Cibicidoides dispars was originally described in Falkland Islands samples as Truncatulina dispars and its test was characterized by a significant difference in porosity between the umbilical (small pores) and the spiral (large pores) sides.The species lives at shelf to upper bathyal depths in temperate waters with moderately low food supply, attached to substrates in high energetic environments.

Representative pictures

Cibicidoides dispars

Specimens

Specimen 6473

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6473
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6473 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacactcacaattatttttgtrtcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatt

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6473 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA ggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6474

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6474
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6474 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttctacacacacacaccacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaa

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6474 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA atgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacga

See sequence on NCBI

Specimen 6476

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6476
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6476 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgagacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttctacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatc

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6476 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacgcaggaatttatttctgcacccctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcat

See sequence on NCBI

Specimen 6479

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6479
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6479 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA taacccgacagtttaaataagtgttaaatgctaccattaaacttatcatatatcacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaatcttcattgaaacacccgttcacgcgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatctttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatc

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6479 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccaggatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6480

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6480
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6480 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ttaaataagtgttaaatgctaccattaaacttatatatatacgcatagaccgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacacatggttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaracacccgttcacgcgggcagatcggtgatcatttttgttttgttggattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacatttttttctacacacacacacacacacacacacactcaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagta

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6480 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA ggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtccgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttacctaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI

Specimen 6481

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6481
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequence

SSU partial

>Cibicidoides dispars | genomic DNA | 6481 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI

Specimen 6483

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6483
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides dispars | genomic DNA | 6483 | taxon:892011 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aataagtgttaaatgctaccattaaacttataatatatcaggcatagagcgattttgtttaccgtagtaacaatttcagcgtgaatcacccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagamagctgcttaatamagtcacacttgtcttgacttggmgcaataaaaattttcattgagacacccgttcacgcgggcagattggtgatcatttttgttttgttgcattcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacaacgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtacattttttttacacacacacacacacacacacacactctaaaattatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaacttgggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacaggggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattatcaacactttcattttttctgttatatcatacacatattatccttgttcgttgtacatcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgcggacgctttgttgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaa

See sequence on NCBI

SSU partial

>Cibicidoides dispars | genomic DNA | 6483 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI